\
| Variant ID: vg0915673890 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15673890 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 213. )
GCGAGCAGTAGAGGATAATAATGTGTTTTTCTTACCGGAAAAAGAAAACAATAAGGTTGAGGATAAGTAAAATATTTATATTAGGTGAGTAGCTATATTT[A/G]
TGACGCCATATTTTTCACCAAAAAATAGTCGGTATGTATTTACATTGTAAGTCCCTAAATTACATATGTATTTTTAGTGTATTTTCAATGTAAGTCCCAA
TTGGGACTTACATTGAAAATACACTAAAAATACATATGTAATTTAGGGACTTACAATGTAAATACATACCGACTATTTTTTGGTGAAAAATATGGCGTCA[T/C]
AAATATAGCTACTCACCTAATATAAATATTTTACTTATCCTCAACCTTATTGTTTTCTTTTTCCGGTAAGAAAAACACATTATTATCCTCTACTGCTCGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.40% | 0.17% | 0.19% | NA |
| All Indica | 2759 | 27.60% | 71.80% | 0.25% | 0.33% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 37.80% | 61.70% | 0.17% | 0.34% | NA |
| Indica II | 465 | 14.20% | 85.20% | 0.43% | 0.22% | NA |
| Indica III | 913 | 24.40% | 75.10% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 31.40% | 67.80% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915673890 | A -> G | LOC_Os09g26050-LOC_Os09g26060 | intergenic_region ; MODIFIER | silent_mutation | Average:50.676; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0915673890 | A -> DEL | N | N | silent_mutation | Average:50.676; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915673890 | NA | 7.17E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 8.00E-07 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 3.52E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 5.27E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 8.98E-07 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 5.07E-09 | mr1728_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 2.62E-09 | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915673890 | NA | 2.90E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |