\
| Variant ID: vg0915671665 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 15671665 |
| Reference Allele: GTTAATA | Alternative Allele: ATTAATA,G |
| Primary Allele: GTTAATA | Secondary Allele: ATTAATA |
Inferred Ancestral Allele: Not determined.
CACGTCCACCCATCCAGCCGCTCTCCTCAGATCCGCAGTACTCCCTCTGTTTCACAATGTAAGTCATTTTAGCATTTCTCACATTCATATTGATGTTAAT[GTTAATA/ATTAATA,G]
AATCTAAATAGATATATATGTCTAGATTCATTAACATCAATATAAATTTGAGAAATACTAGAATGACTTATATTGTTAAACGGAGGGAGTAGCAAATTAA
TTAATTTGCTACTCCCTCCGTTTAACAATATAAGTCATTCTAGTATTTCTCAAATTTATATTGATGTTAATGAATCTAGACATATATATCTATTTAGATT[TATTAAC/TATTAAT,C]
ATTAACATCAATATGAATGTGAGAAATGCTAAAATGACTTACATTGTGAAACAGAGGGAGTACTGCGGATCTGAGGAGAGCGGCTGGATGGGTGGACGTG
| Populations | Population Size | Frequency of GTTAATA(primary allele) | Frequency of ATTAATA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 8.90% | 1.04% | 0.00% | G: 0.11% |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 70.20% | 26.70% | 2.91% | 0.00% | G: 0.20% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 2.70% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 67.70% | 3.17% | 0.00% | G: 0.60% |
| Japonica Intermediate | 241 | 78.00% | 17.00% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 3.33% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915671665 | GTTAATA -> G | LOC_Os09g26050-LOC_Os09g26060 | intergenic_region ; MODIFIER | silent_mutation | Average:50.993; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg0915671665 | GTTAATA -> ATTAATA | LOC_Os09g26050-LOC_Os09g26060 | intergenic_region ; MODIFIER | silent_mutation | Average:50.993; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915671665 | NA | 2.29E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0915671665 | NA | 7.85E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | 2.21E-06 | 3.60E-36 | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 2.15E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 7.61E-19 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 9.60E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 2.24E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 9.71E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 6.17E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 2.24E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 1.41E-28 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 8.45E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 2.89E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 6.47E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 3.27E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 5.97E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 4.02E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915671665 | NA | 3.04E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |