\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915536354:

Variant ID: vg0915536354 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15536354
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, T: 0.35, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGACGAGACCTCGTTGCAATGATCAGAATGTCCAAACAATTCTACTGAAACCAACCTCTGGCATCCAGAATTGTTTTGTGTTACTCTTTGCAGAAGAG[T/G]
TCACGCGGCCAAGATGTCATAGCCTTATCCGCAGAGCCAGTAGTCAACCGGTGGTCAGGTAGCTCAGTTGGTGAGAGTTGTGGGTGAAAACCAACCACTA

Reverse complement sequence

TAGTGGTTGGTTTTCACCCACAACTCTCACCAACTGAGCTACCTGACCACCGGTTGACTACTGGCTCTGCGGATAAGGCTATGACATCTTGGCCGCGTGA[A/C]
CTCTTCTGCAAAGAGTAACACAAAACAATTCTGGATGCCAGAGGTTGGTTTCAGTAGAATTGTTTGGACATTCTGATCATTGCAACGAGGTCTCGTCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.90% 0.02% 0.00% NA
All Indica  2759 97.60% 2.30% 0.04% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 39.00% 61.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.80% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 28.90% 71.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915536354 T -> G LOC_Os09g25890.1 downstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:71.625; most accessible tissue: Minghui63 root, score: 93.25 N N N N
vg0915536354 T -> G LOC_Os09g25890.2 downstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:71.625; most accessible tissue: Minghui63 root, score: 93.25 N N N N
vg0915536354 T -> G LOC_Os09g25890-LOC_Os09g25900 intergenic_region ; MODIFIER silent_mutation Average:71.625; most accessible tissue: Minghui63 root, score: 93.25 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0915536354 T G 0.07 0.02 0.01 0.07 0.06 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915536354 NA 8.88E-40 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 3.47E-44 mr1534 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 2.86E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 1.38E-63 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 1.32E-61 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 2.02E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 6.69E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 5.48E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 8.21E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 6.21E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 1.74E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915536354 NA 5.06E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251