\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915457997:

Variant ID: vg0915457997 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15457997
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAACATCGTTCTCGTGTCAGTCGACAGAATCATATACTCCATCCGTTTTAAAATATAAGTATTTTTGATTCTGATACAGTATGCTCTCTCCGTACTT[A/G]
TAAAGGAAGTTGTTTAGAATAATGTTTAAGTCAAACCTTAGGAATATAAATCATAAATCATTCTCAAGTTGTTGAGTTTGAAAATGCAAAATTTATATGA

Reverse complement sequence

TCATATAAATTTTGCATTTTCAAACTCAACAACTTGAGAATGATTTATGATTTATATTCCTAAGGTTTGACTTAAACATTATTCTAAACAACTTCCTTTA[T/C]
AAGTACGGAGAGAGCATACTGTATCAGAATCAAAAATACTTATATTTTAAAACGGATGGAGTATATGATTCTGTCGACTGACACGAGAACGATGTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 18.60% 0.36% 16.76% NA
All Indica  2759 44.40% 26.70% 0.62% 28.34% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.13% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 23.90% 40.30% 0.50% 35.29% NA
Indica II  465 65.80% 19.80% 0.43% 13.98% NA
Indica III  913 43.80% 25.40% 0.33% 30.45% NA
Indica Intermediate  786 47.80% 21.90% 1.15% 29.13% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 11.10% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915457997 A -> G LOC_Os09g25784.1 upstream_gene_variant ; 1985.0bp to feature; MODIFIER silent_mutation Average:49.855; most accessible tissue: Callus, score: 81.054 N N N N
vg0915457997 A -> G LOC_Os09g25784.2 upstream_gene_variant ; 1985.0bp to feature; MODIFIER silent_mutation Average:49.855; most accessible tissue: Callus, score: 81.054 N N N N
vg0915457997 A -> G LOC_Os09g25800.1 intron_variant ; MODIFIER silent_mutation Average:49.855; most accessible tissue: Callus, score: 81.054 N N N N
vg0915457997 A -> DEL N N silent_mutation Average:49.855; most accessible tissue: Callus, score: 81.054 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915457997 NA 5.10E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 3.91E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 3.93E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 2.14E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 2.57E-06 2.57E-06 mr1717 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 3.39E-07 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 7.27E-06 NA mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 3.43E-07 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 9.22E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 2.47E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997 NA 4.96E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251