Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915457997:

Variant ID: vg0915457997 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15457997
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGAACATCGTTCTCGTGTCAGTCGACAGAATCATATACTCCATCCGTTTTAAAATATAAGTATTTTTGATTCTGATACAGTATGCTCTCTCCGTACTT[A/G]
TAAAGGAAGTTGTTTAGAATAATGTTTAAGTCAAACCTTAGGAATATAAATCATAAATCATTCTCAAGTTGTTGAGTTTGAAAATGCAAAATTTATATGA

Reverse complement sequence

TCATATAAATTTTGCATTTTCAAACTCAACAACTTGAGAATGATTTATGATTTATATTCCTAAGGTTTGACTTAAACATTATTCTAAACAACTTCCTTTA[T/C]
AAGTACGGAGAGAGCATACTGTATCAGAATCAAAAATACTTATATTTTAAAACGGATGGAGTATATGATTCTGTCGACTGACACGAGAACGATGTTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	18.60%	0.36%	16.76%	NA
All Indica	2759	44.40%	26.70%	0.62%	28.34%	NA
All Japonica	1512	99.70%	0.20%	0.00%	0.13%	NA
Aus	269	51.70%	48.30%	0.00%	0.00%	NA
Indica I	595	23.90%	40.30%	0.50%	35.29%	NA
Indica II	465	65.80%	19.80%	0.43%	13.98%	NA
Indica III	913	43.80%	25.40%	0.33%	30.45%	NA
Indica Intermediate	786	47.80%	21.90%	1.15%	29.13%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	11.10%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915457997	A -> G	LOC_Os09g25784.1	upstream_gene_variant ; 1985.0bp to feature; MODIFIER	silent_mutation	Average:49.855; most accessible tissue: Callus, score: 81.054	N	N	N	N
vg0915457997	A -> G	LOC_Os09g25784.2	upstream_gene_variant ; 1985.0bp to feature; MODIFIER	silent_mutation	Average:49.855; most accessible tissue: Callus, score: 81.054	N	N	N	N
vg0915457997	A -> G	LOC_Os09g25800.1	intron_variant ; MODIFIER	silent_mutation	Average:49.855; most accessible tissue: Callus, score: 81.054	N	N	N	N
vg0915457997	A -> DEL	N	N	silent_mutation	Average:49.855; most accessible tissue: Callus, score: 81.054	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915457997	NA	5.10E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	3.91E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	3.93E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	2.14E-06	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	2.57E-06	2.57E-06	mr1717	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	3.39E-07	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	7.27E-06	NA	mr1013_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	3.43E-07	mr1013_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	9.22E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	2.47E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915457997	NA	4.96E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251