Variant ID: vg0915457997 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 15457997 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 32. )
AAAGAACATCGTTCTCGTGTCAGTCGACAGAATCATATACTCCATCCGTTTTAAAATATAAGTATTTTTGATTCTGATACAGTATGCTCTCTCCGTACTT[A/G]
TAAAGGAAGTTGTTTAGAATAATGTTTAAGTCAAACCTTAGGAATATAAATCATAAATCATTCTCAAGTTGTTGAGTTTGAAAATGCAAAATTTATATGA
TCATATAAATTTTGCATTTTCAAACTCAACAACTTGAGAATGATTTATGATTTATATTCCTAAGGTTTGACTTAAACATTATTCTAAACAACTTCCTTTA[T/C]
AAGTACGGAGAGAGCATACTGTATCAGAATCAAAAATACTTATATTTTAAAACGGATGGAGTATATGATTCTGTCGACTGACACGAGAACGATGTTCTTT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.30% | 18.60% | 0.36% | 16.76% | NA |
All Indica | 2759 | 44.40% | 26.70% | 0.62% | 28.34% | NA |
All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.13% | NA |
Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 23.90% | 40.30% | 0.50% | 35.29% | NA |
Indica II | 465 | 65.80% | 19.80% | 0.43% | 13.98% | NA |
Indica III | 913 | 43.80% | 25.40% | 0.33% | 30.45% | NA |
Indica Intermediate | 786 | 47.80% | 21.90% | 1.15% | 29.13% | NA |
Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 11.10% | 0.00% | 8.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0915457997 | A -> G | LOC_Os09g25784.1 | upstream_gene_variant ; 1985.0bp to feature; MODIFIER | silent_mutation | Average:49.855; most accessible tissue: Callus, score: 81.054 | N | N | N | N |
vg0915457997 | A -> G | LOC_Os09g25784.2 | upstream_gene_variant ; 1985.0bp to feature; MODIFIER | silent_mutation | Average:49.855; most accessible tissue: Callus, score: 81.054 | N | N | N | N |
vg0915457997 | A -> G | LOC_Os09g25800.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.855; most accessible tissue: Callus, score: 81.054 | N | N | N | N |
vg0915457997 | A -> DEL | N | N | silent_mutation | Average:49.855; most accessible tissue: Callus, score: 81.054 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0915457997 | NA | 5.10E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 3.91E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 3.93E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 2.14E-06 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | 2.57E-06 | 2.57E-06 | mr1717 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 3.39E-07 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | 7.27E-06 | NA | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 3.43E-07 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 9.22E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 2.47E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915457997 | NA | 4.96E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |