| Variant ID: vg0915452616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15452616 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGACTAATAACAAAACAAATTACAGACTCCACATGTAAACTGAGACAAATCTATTAAGCCTAATTAATTCATCATTAGTAAATGTTTATTGTAGCACCA[C/T]
ATTGTTAAATCATAACGTAACTAGCATGGTGGCCCGCGCAGATTACGCGGCTAGCATCATTATATTTTCTCTCATATAATAGCATATATGTTTTCTTAAT
ATTAAGAAAACATATATGCTATTATATGAGAGAAAATATAATGATGCTAGCCGCGTAATCTGCGCGGGCCACCATGCTAGTTACGTTATGATTTAACAAT[G/A]
TGGTGCTACAATAAACATTTACTAATGATGAATTAATTAGGCTTAATAGATTTGTCTCAGTTTACATGTGGAGTCTGTAATTTGTTTTGTTATTAGTCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 15.30% | 0.11% | 17.18% | NA |
| All Indica | 2759 | 44.90% | 25.80% | 0.18% | 29.07% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.70% | 40.20% | 0.50% | 35.63% | NA |
| Indica II | 465 | 66.50% | 18.70% | 0.00% | 14.84% | NA |
| Indica III | 913 | 44.70% | 24.80% | 0.00% | 30.56% | NA |
| Indica Intermediate | 786 | 48.50% | 20.50% | 0.25% | 30.79% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 5.60% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915452616 | C -> DEL | N | N | silent_mutation | Average:29.887; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0915452616 | C -> T | LOC_Os09g25770.1 | upstream_gene_variant ; 2604.0bp to feature; MODIFIER | silent_mutation | Average:29.887; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0915452616 | C -> T | LOC_Os09g25770.2 | upstream_gene_variant ; 2604.0bp to feature; MODIFIER | silent_mutation | Average:29.887; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0915452616 | C -> T | LOC_Os09g25784.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.887; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0915452616 | C -> T | LOC_Os09g25784.2 | intron_variant ; MODIFIER | silent_mutation | Average:29.887; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915452616 | NA | 9.10E-20 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452616 | 2.43E-06 | 7.45E-13 | mr1717 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452616 | 4.49E-09 | 4.49E-09 | mr1717 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452616 | NA | 4.44E-10 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |