Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915451165:

Variant ID: vg0915451165 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15451165
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATTTCCTTCGTCCTAACCTATAAAGAGTTTTGGTTAGATAAGACATATACTAGTACCACGAATCTGGACAAATAGTCAGTCCAAATTTATCGTATTA[C/T]
GATGTATTACATCCAACCAAAACTCCTAATATGAAGGGAGTAGATGAGATGTGAGATAAAGAACATGTATAGAGTGTTCTTATTATTGGGACGGGTGAGG

Reverse complement sequence

CCTCACCCGTCCCAATAATAAGAACACTCTATACATGTTCTTTATCTCACATCTCATCTACTCCCTTCATATTAGGAGTTTTGGTTGGATGTAATACATC[G/A]
TAATACGATAAATTTGGACTGACTATTTGTCCAGATTCGTGGTACTAGTATATGTCTTATCTAACCAAAACTCTTTATAGGTTAGGACGAAGGAAATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	41.60%	1.80%	3.13%	NA
All Indica	2759	31.10%	60.50%	3.08%	5.36%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	38.00%	47.20%	8.24%	6.55%	NA
Indica II	465	17.00%	76.10%	2.37%	4.52%	NA
Indica III	913	32.10%	60.70%	1.10%	6.13%	NA
Indica Intermediate	786	33.00%	61.10%	1.91%	4.07%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915451165	C -> DEL	N	N	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N
vg0915451165	C -> T	LOC_Os09g25770.1	upstream_gene_variant ; 1153.0bp to feature; MODIFIER	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N
vg0915451165	C -> T	LOC_Os09g25770.2	upstream_gene_variant ; 1153.0bp to feature; MODIFIER	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N
vg0915451165	C -> T	LOC_Os09g25760.1	downstream_gene_variant ; 4563.0bp to feature; MODIFIER	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N
vg0915451165	C -> T	LOC_Os09g25784.2	downstream_gene_variant ; 119.0bp to feature; MODIFIER	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N
vg0915451165	C -> T	LOC_Os09g25784.1	intron_variant ; MODIFIER	silent_mutation	Average:81.584; most accessible tissue: Zhenshan97 root, score: 89.721	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0915451165	C	T	0.03	0.0	0.0	-0.01	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915451165	NA	9.91E-12	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	2.15E-12	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	4.89E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	7.10E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	4.33E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	8.69E-14	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	1.03E-14	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	2.34E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	2.53E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	7.41E-23	mr1767	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	2.36E-16	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	1.35E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	7.28E-06	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915451165	NA	5.04E-06	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251