Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915361320:

Variant ID: vg0915361320 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15361320
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTCCACAGTGTAGCCAAAATTCTTGATGCTTCTTTGTTTGCATACACTATCTCATGATTACAACCATTAATACAAGTTGTGCCCGTGAATGTATTTT[C/T]
CTAACAAGTTGTTTAGCATATAGAATGTTTCTATTTTCACGATTACCCTTGAATCGTTTCATGTTTCATACATGTAGAAACATTTTATATAAGGAGATTT

Reverse complement sequence

AAATCTCCTTATATAAAATGTTTCTACATGTATGAAACATGAAACGATTCAAGGGTAATCGTGAAAATAGAAACATTCTATATGCTAAACAACTTGTTAG[G/A]
AAAATACATTCACGGGCACAACTTGTATTAATGGTTGTAATCATGAGATAGTGTATGCAAACAAAGAAGCATCAAGAATTTTGGCTACACTGTGGAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	15.70%	0.17%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	55.00%	44.40%	0.53%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	94.50%	4.80%	0.65%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	32.80%	66.00%	1.24%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915361320	C -> T	LOC_Os09g25600.1	upstream_gene_variant ; 3571.0bp to feature; MODIFIER	silent_mutation	Average:38.7; most accessible tissue: Callus, score: 73.214	N	N	N	N
vg0915361320	C -> T	LOC_Os09g25590.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:38.7; most accessible tissue: Callus, score: 73.214	N	N	N	N
vg0915361320	C -> T	LOC_Os09g25590-LOC_Os09g25600	intergenic_region ; MODIFIER	silent_mutation	Average:38.7; most accessible tissue: Callus, score: 73.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915361320	NA	3.69E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.54E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	8.59E-17	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.00E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.06E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.20E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.41E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.37E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	5.10E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.48E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	5.11E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.94E-19	mr1552_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	3.70E-11	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	5.20E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	6.37E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.45E-08	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.49E-28	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	4.48E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.68E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	2.32E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	1.50E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	4.27E-21	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	4.02E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	3.23E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915361320	NA	3.86E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251