\
| Variant ID: vg0915298743 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 15298743 |
| Reference Allele: A | Alternative Allele: AATAATTTGTGTT,AATAATTTGTGTTACT,AATAATCTGTGTTACT,G,AATAATCTGTGTTACTCCTCT,AATAAT |
| Primary Allele: A | Secondary Allele: AATAATTTGTGTTACT |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 76. )
CTCCATCATGTTTACTCTGACTTTTGAGTGTAAGCAATCATTTAATTTTACATGATACAACCACGATCCAATCTTTATGTGCATGCATTTGTTTTTAGGG[A/AATAATTTGTGTT,AATAATTTGTGTTACT,AATAATCTGTGTTACT,G,AATAATCTGTGTTACTCCTCT,AATAAT]
CCGCCTATTCTGCAGTCGATTGCAATTTTTGCGTTTGGTCAGTCAACTTTATGCACCATTAGATATGTATCTAACGGTAAAGCTCAAAAAATCAAAACGT
ACGTTTTGATTTTTTGAGCTTTACCGTTAGATACATATCTAATGGTGCATAAAGTTGACTGACCAAACGCAAAAATTGCAATCGACTGCAGAATAGGCGG[T/AACACAAATTATT,AGTAACACAAATTATT,AGTAACACAGATTATT,C,AGAGGAGTAACACAGATTATT,ATTATT]
CCCTAAAAACAAATGCATGCACATAAAGATTGGATCGTGGTTGTATCATGTAAAATTAAATGATTGCTTACACTCAAAAGTCAGAGTAAACATGATGGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AATAATTTGTGTTACT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.50% | 5.70% | 23.23% | 32.63% | G: 2.79%; AATAATTTGTGTT: 1.48%; AATAATCTGTGTTACT: 0.44%; AATAAT: 0.19%; AATAATCTGTGTTACTCCTCT: 0.08% |
| All Indica | 2759 | 2.50% | 8.30% | 32.84% | 53.03% | AATAATTTGTGTT: 2.17%; AATAATCTGTGTTACT: 0.69%; AATAAT: 0.33%; AATAATCTGTGTTACTCCTCT: 0.14% |
| All Japonica | 1512 | 89.40% | 0.10% | 1.46% | 0.40% | G: 8.60%; AATAATCTGTGTTACT: 0.07% |
| Aus | 269 | 2.60% | 12.60% | 57.99% | 23.42% | AATAATTTGTGTT: 3.35% |
| Indica I | 595 | 1.00% | 3.00% | 28.74% | 64.87% | AATAATTTGTGTT: 1.01%; AATAATCTGTGTTACT: 0.50%; AATAAT: 0.50%; AATAATCTGTGTTACTCCTCT: 0.34% |
| Indica II | 465 | 5.20% | 4.30% | 23.87% | 64.30% | AATAATTTGTGTT: 1.72%; AATAATCTGTGTTACT: 0.22%; AATAATCTGTGTTACTCCTCT: 0.22%; AATAAT: 0.22% |
| Indica III | 913 | 1.20% | 15.20% | 38.88% | 40.42% | AATAATTTGTGTT: 2.85%; AATAATCTGTGTTACT: 1.10%; AATAAT: 0.22%; AATAATCTGTGTTACTCCTCT: 0.11% |
| Indica Intermediate | 786 | 3.40% | 6.70% | 34.22% | 52.04% | AATAATTTGTGTT: 2.54%; AATAATCTGTGTTACT: 0.64%; AATAAT: 0.38% |
| Temperate Japonica | 767 | 95.00% | 0.10% | 1.04% | 0.26% | G: 3.39%; AATAATCTGTGTTACT: 0.13% |
| Tropical Japonica | 504 | 94.00% | 0.20% | 0.40% | 0.40% | G: 4.96% |
| Japonica Intermediate | 241 | 61.40% | 0.00% | 4.98% | 0.83% | G: 32.78% |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 2.08% | G: 1.04% |
| Intermediate | 90 | 70.00% | 2.20% | 15.56% | 8.89% | AATAATCTGTGTTACT: 1.11%; AATAATTTGTGTT: 1.11%; G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915298743 | A -> DEL | N | N | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> G | LOC_Os09g25510.1 | upstream_gene_variant ; 1262.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> G | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATTTGTGTT | LOC_Os09g25510.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATTTGTGTT | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAAT | LOC_Os09g25510.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAAT | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATTTGTGTTACT | LOC_Os09g25510.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATTTGTGTTACT | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATCTGTGTTACT | LOC_Os09g25510.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATCTGTGTTACT | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATCTGTGTTACTCCTCT | LOC_Os09g25510.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0915298743 | A -> AATAATCTGTGTTACTCCTCT | LOC_Os09g25500-LOC_Os09g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.179; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915298743 | 6.43E-08 | 3.81E-10 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 9.22E-09 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 3.79E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 4.95E-07 | 3.04E-12 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.35E-10 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 2.88E-07 | 1.69E-10 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 3.68E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 2.24E-06 | 1.93E-10 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 8.16E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.61E-09 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.58E-09 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 1.80E-06 | 7.18E-10 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.82E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 1.87E-07 | 9.96E-13 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 1.16E-06 | 2.00E-09 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 5.36E-07 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 5.27E-09 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 1.62E-06 | 1.93E-11 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 9.42E-09 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 3.70E-06 | 4.19E-11 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 4.29E-10 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 3.43E-06 | 3.72E-11 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 6.57E-09 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 5.75E-09 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 3.35E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.30E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 2.84E-06 | 2.32E-12 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 4.18E-09 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 5.42E-09 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 2.59E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | 1.07E-06 | 2.28E-12 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 1.02E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915298743 | NA | 3.86E-06 | mr1961_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |