\
| Variant ID: vg0915258271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15258271 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTTTTCACCCCTAGAAGCCAATTATCAAAAATATGTGATATACCATGAGGAAGGTAAAGAACAAAAGAAAACTGAACTGCTCTCCATAAAAACTTTT[C/T]
ATAATGATACTCCACAAATAGATGTTGAATAGTCTCATTTTTCATACAGAAACAACATCTCAAGCTACCATTCCAATTTCTCGTGGCCAAATTATCTTTA
TAAAGATAATTTGGCCACGAGAAATTGGAATGGTAGCTTGAGATGTTGTTTCTGTATGAAAAATGAGACTATTCAACATCTATTTGTGGAGTATCATTAT[G/A]
AAAAGTTTTTATGGAGAGCAGTTCAGTTTTCTTTTGTTCTTTACCTTCCTCATGGTATATCACATATTTTTGATAATTGGCTTCTAGGGGTGAAAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 2.00% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 6.00% | 1.32% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 84.50% | 12.10% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 9.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915258271 | C -> T | LOC_Os09g25460.1 | upstream_gene_variant ; 1943.0bp to feature; MODIFIER | silent_mutation | Average:32.3; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0915258271 | C -> T | LOC_Os09g25460-LOC_Os09g25470 | intergenic_region ; MODIFIER | silent_mutation | Average:32.3; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915258271 | NA | 5.06E-06 | mr1044 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915258271 | NA | 5.08E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915258271 | NA | 8.59E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915258271 | NA | 7.35E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915258271 | NA | 5.25E-10 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915258271 | NA | 7.89E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |