| Variant ID: vg0915243571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15243571 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 99. )
TGGTCCAATCAAACGGTCATTCCTGTGTTTTTGCAATCATCTGTTTTATACTTACATTTCTATTAAAATCCTACGTTTTTTTTCTATTCCTACGTTTTTT[C/T]
AATTCTACGATTTAAAGGGTCCCTAAGTTTTTTTTAGAAAACATAAATTTACATGTGTAAAACAAATAATCCTAGATAATAATCCGTTGTCCAAAAAGAG
CTCTTTTTGGACAACGGATTATTATCTAGGATTATTTGTTTTACACATGTAAATTTATGTTTTCTAAAAAAAACTTAGGGACCCTTTAAATCGTAGAATT[G/A]
AAAAAACGTAGGAATAGAAAAAAAACGTAGGATTTTAATAGAAATGTAAGTATAAAACAGATGATTGCAAAAACACAGGAATGACCGTTTGATTGGACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.00% | 30.70% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 52.30% | 47.10% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.80% | 47.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.00% | 40.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 38.30% | 61.10% | 0.65% | 0.00% | NA |
| Indica III | 913 | 60.10% | 39.30% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 46.40% | 52.70% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915243571 | C -> T | LOC_Os09g25430.1 | upstream_gene_variant ; 1087.0bp to feature; MODIFIER | silent_mutation | Average:31.253; most accessible tissue: Callus, score: 58.386 | N | N | N | N |
| vg0915243571 | C -> T | LOC_Os09g25440.1 | downstream_gene_variant ; 1331.0bp to feature; MODIFIER | silent_mutation | Average:31.253; most accessible tissue: Callus, score: 58.386 | N | N | N | N |
| vg0915243571 | C -> T | LOC_Os09g25430-LOC_Os09g25440 | intergenic_region ; MODIFIER | silent_mutation | Average:31.253; most accessible tissue: Callus, score: 58.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915243571 | NA | 1.71E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 8.75E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 1.44E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 2.70E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 9.28E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 4.38E-07 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 7.82E-07 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | 7.11E-06 | NA | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 2.71E-09 | mr1010_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915243571 | NA | 8.99E-06 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |