Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915243571:

Variant ID: vg0915243571 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15243571
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTCCAATCAAACGGTCATTCCTGTGTTTTTGCAATCATCTGTTTTATACTTACATTTCTATTAAAATCCTACGTTTTTTTTCTATTCCTACGTTTTTT[C/T]
AATTCTACGATTTAAAGGGTCCCTAAGTTTTTTTTAGAAAACATAAATTTACATGTGTAAAACAAATAATCCTAGATAATAATCCGTTGTCCAAAAAGAG

Reverse complement sequence

CTCTTTTTGGACAACGGATTATTATCTAGGATTATTTGTTTTACACATGTAAATTTATGTTTTCTAAAAAAAACTTAGGGACCCTTTAAATCGTAGAATT[G/A]
AAAAAACGTAGGAATAGAAAAAAAACGTAGGATTTTAATAGAAATGTAAGTATAAAACAGATGATTGCAAAAACACAGGAATGACCGTTTGATTGGACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	30.70%	0.34%	0.00%	NA
All Indica	2759	52.30%	47.10%	0.58%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	59.00%	40.80%	0.17%	0.00%	NA
Indica II	465	38.30%	61.10%	0.65%	0.00%	NA
Indica III	913	60.10%	39.30%	0.55%	0.00%	NA
Indica Intermediate	786	46.40%	52.70%	0.89%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915243571	C -> T	LOC_Os09g25430.1	upstream_gene_variant ; 1087.0bp to feature; MODIFIER	silent_mutation	Average:31.253; most accessible tissue: Callus, score: 58.386	N	N	N	N
vg0915243571	C -> T	LOC_Os09g25440.1	downstream_gene_variant ; 1331.0bp to feature; MODIFIER	silent_mutation	Average:31.253; most accessible tissue: Callus, score: 58.386	N	N	N	N
vg0915243571	C -> T	LOC_Os09g25430-LOC_Os09g25440	intergenic_region ; MODIFIER	silent_mutation	Average:31.253; most accessible tissue: Callus, score: 58.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915243571	NA	1.71E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	8.75E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	1.44E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	2.70E-06	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	9.28E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	4.38E-07	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	7.82E-07	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	7.11E-06	NA	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	2.71E-09	mr1010_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915243571	NA	8.99E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251