| Variant ID: vg0915107342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15107342 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )
AATTTCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCGATTCATATATGACATCGGCTCAAAGATAAATGATATGTCA[T/A]
CGGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTCTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCATGCTAACAC
GTGTTAGCATGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAAGAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCCG[A/T]
TGACATATCATTTATCTTTGAGCCGATGTCATATATGAATCGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 20.70% | 2.24% | 0.68% | NA |
| All Indica | 2759 | 64.80% | 34.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.90% | 0.00% | 34.94% | 11.15% | NA |
| Indica I | 595 | 66.10% | 33.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 43.90% | 55.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 75.10% | 24.10% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 64.10% | 35.20% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915107342 | T -> DEL | N | N | silent_mutation | Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0915107342 | T -> A | LOC_Os09g25220.1 | upstream_gene_variant ; 3744.0bp to feature; MODIFIER | silent_mutation | Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0915107342 | T -> A | LOC_Os09g25210-LOC_Os09g25220 | intergenic_region ; MODIFIER | silent_mutation | Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915107342 | NA | 3.22E-06 | mr1004 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 6.90E-07 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 1.58E-07 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 5.43E-07 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 7.34E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 2.80E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 1.76E-07 | mr1006_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 1.77E-08 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 3.59E-06 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107342 | NA | 2.12E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |