\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915107342:

Variant ID: vg0915107342 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15107342
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCGATTCATATATGACATCGGCTCAAAGATAAATGATATGTCA[T/A]
CGGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTCTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCATGCTAACAC

Reverse complement sequence

GTGTTAGCATGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAAGAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCCG[A/T]
TGACATATCATTTATCTTTGAGCCGATGTCATATATGAATCGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 20.70% 2.24% 0.68% NA
All Indica  2759 64.80% 34.70% 0.43% 0.07% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 53.90% 0.00% 34.94% 11.15% NA
Indica I  595 66.10% 33.80% 0.17% 0.00% NA
Indica II  465 43.90% 55.90% 0.22% 0.00% NA
Indica III  913 75.10% 24.10% 0.77% 0.00% NA
Indica Intermediate  786 64.10% 35.20% 0.38% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915107342 T -> DEL N N silent_mutation Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0915107342 T -> A LOC_Os09g25220.1 upstream_gene_variant ; 3744.0bp to feature; MODIFIER silent_mutation Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0915107342 T -> A LOC_Os09g25210-LOC_Os09g25220 intergenic_region ; MODIFIER silent_mutation Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915107342 NA 3.22E-06 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 6.90E-07 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 1.58E-07 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 5.43E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 7.34E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 2.80E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 1.76E-07 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 1.77E-08 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 3.59E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342 NA 2.12E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251