Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915107342:

Variant ID: vg0915107342 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15107342
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCGATTCATATATGACATCGGCTCAAAGATAAATGATATGTCA[T/A]
CGGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTCTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCATGCTAACAC

Reverse complement sequence

GTGTTAGCATGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAAGAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCCG[A/T]
TGACATATCATTTATCTTTGAGCCGATGTCATATATGAATCGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	20.70%	2.24%	0.68%	NA
All Indica	2759	64.80%	34.70%	0.43%	0.07%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	53.90%	0.00%	34.94%	11.15%	NA
Indica I	595	66.10%	33.80%	0.17%	0.00%	NA
Indica II	465	43.90%	55.90%	0.22%	0.00%	NA
Indica III	913	75.10%	24.10%	0.77%	0.00%	NA
Indica Intermediate	786	64.10%	35.20%	0.38%	0.25%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915107342	T -> DEL	N	N	silent_mutation	Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635	N	N	N	N
vg0915107342	T -> A	LOC_Os09g25220.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635	N	N	N	N
vg0915107342	T -> A	LOC_Os09g25210-LOC_Os09g25220	intergenic_region ; MODIFIER	silent_mutation	Average:25.546; most accessible tissue: Zhenshan97 root, score: 44.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915107342	NA	3.22E-06	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	6.90E-07	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	1.58E-07	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	5.43E-07	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	7.34E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	2.80E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	1.76E-07	mr1006_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	1.77E-08	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	3.59E-06	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107342	NA	2.12E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251