\
| Variant ID: vg0915107312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15107312 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 186. )
TATATATCGATATAAGAACTATATATTGGTAATTTCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCGATTCATATAT[G/A]
ACATCGGCTCAAAGATAAATGATATGTCATCGGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTCTTTGTTTCTATTTCTTGTTGATT
AATCAACAAGAAATAGAAACAAAGAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCCGATGACATATCATTTATCTTTGAGCCGATGT[C/T]
ATATATGAATCGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGAAATTACCAATATATAGTTCTTATATCGATATATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 35.70% | 2.52% | 0.36% | NA |
| All Indica | 2759 | 98.60% | 0.90% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 50.60% | 4.50% | 38.66% | 6.32% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.40% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915107312 | G -> DEL | N | N | silent_mutation | Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| vg0915107312 | G -> A | LOC_Os09g25220.1 | upstream_gene_variant ; 3774.0bp to feature; MODIFIER | silent_mutation | Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| vg0915107312 | G -> A | LOC_Os09g25210-LOC_Os09g25220 | intergenic_region ; MODIFIER | silent_mutation | Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915107312 | NA | 3.44E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.09E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 6.34E-36 | mr1081_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 8.45E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 3.92E-13 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.15E-17 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 4.68E-39 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.23E-49 | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 4.40E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 3.00E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 7.09E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 3.93E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | 1.03E-06 | 1.33E-39 | mr1256_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 7.31E-08 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 6.71E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.78E-25 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.00E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.47E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 2.26E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 2.15E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 1.19E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 7.59E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 6.46E-33 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 7.19E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915107312 | NA | 4.23E-43 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |