| Variant ID: vg0915096631 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15096631 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 291. )
GGCGAGTATTCTGGTGGCGACAGACCAGTTAGGTCGCGGGTTGGAAAGATGGCGCCGACAGGTATGAAATTTGATTTGGTGAAGTTTGACGGCTCCGGAA[A/T]
TTTTGGCTTGTGGCAAACCAAGGTCAAAGATTTGTTAGCTCAACAAGGAGTTTCAAAGGCTTTGAAGGGTGAAAAACCGGCCAAGATGGAGGATGACGAT
ATCGTCATCCTCCATCTTGGCCGGTTTTTCACCCTTCAAAGCCTTTGAAACTCCTTGTTGAGCTAACAAATCTTTGACCTTGGTTTGCCACAAGCCAAAA[T/A]
TTCCGGAGCCGTCAAACTTCACCAAATCAAATTTCATACCTGTCGGCGCCATCTTTCCAACCCGCGACCTAACTGGTCTGTCGCCACCAGAATACTCGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 16.60% | 1.50% | 2.88% | NA |
| All Indica | 2759 | 64.70% | 28.00% | 2.50% | 4.86% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.74% | 0.74% | NA |
| Indica I | 595 | 53.10% | 37.10% | 2.35% | 7.39% | NA |
| Indica II | 465 | 83.20% | 12.90% | 0.22% | 3.66% | NA |
| Indica III | 913 | 62.30% | 30.10% | 3.50% | 4.05% | NA |
| Indica Intermediate | 786 | 65.10% | 27.50% | 2.80% | 4.58% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915096631 | A -> DEL | LOC_Os09g25200.1 | N | frameshift_variant | Average:40.213; most accessible tissue: Zhenshan97 young leaf, score: 49.329 | N | N | N | N |
| vg0915096631 | A -> T | LOC_Os09g25200.1 | missense_variant ; p.Asn353Ile; MODERATE | nonsynonymous_codon | Average:40.213; most accessible tissue: Zhenshan97 young leaf, score: 49.329 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915096631 | NA | 5.16E-06 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 2.15E-06 | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 1.33E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 3.47E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 1.57E-06 | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 4.56E-09 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | 4.33E-06 | 4.32E-06 | mr1717 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 6.25E-06 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 2.70E-07 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915096631 | NA | 8.70E-06 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |