| Variant ID: vg0915089225 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 15089225 |
| Reference Allele: CA | Alternative Allele: CAGAA,C,CAGA,GA |
| Primary Allele: CA | Secondary Allele: CAGAA |
Inferred Ancestral Allele: Not determined.
CACGTTAGCTTAGCTGAGACCACCTTGGTTGCTACTCTACTACCTACTCGTCTCGTGATGCATGCGGTGACAGTAGTAGTACCAACTACTCCCTCCGTCC[CA/CAGAA,C,CAGA,GA]
AAAAAAGGCAAACCCTGGATTTCCATGTCCAACTTTGACTGTCCGTCTTATATGAATTTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGGTAAAAC
GTTTTACCATCTAACAACAATAAAAATACGAATTATAAAAAAAATTCATATAAGACGGACAGTCAAAGTTGGACATGGAAATCCAGGGTTTGCCTTTTTT[TG/TTCTG,G,TCTG,TC]
GGACGGAGGGAGTAGTTGGTACTACTACTGTCACCGCATGCATCACGAGACGAGTAGGTAGTAGAGTAGCAACCAAGGTGGTCTCAGCTAAGCTAACGTG
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of CAGAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 21.90% | 0.30% | 2.69% | GA: 0.13%; C: 0.06%; CAGA: 0.04% |
| All Indica | 2759 | 99.20% | 0.40% | 0.00% | 0.25% | GA: 0.14% |
| All Japonica | 1512 | 39.90% | 59.60% | 0.26% | 0.13% | C: 0.07% |
| Aus | 269 | 51.70% | 2.20% | 2.23% | 43.12% | GA: 0.74% |
| Indica I | 595 | 99.50% | 0.20% | 0.00% | 0.00% | GA: 0.34% |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.00% | GA: 0.22% |
| Indica III | 913 | 99.60% | 0.10% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 98.60% | 0.80% | 0.00% | 0.51% | GA: 0.13% |
| Temperate Japonica | 767 | 67.00% | 32.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.00% | 0.20% | 0.00% | C: 0.20% |
| Japonica Intermediate | 241 | 27.80% | 70.50% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 11.50% | 85.40% | 0.00% | 1.04% | CAGA: 2.08% |
| Intermediate | 90 | 54.40% | 37.80% | 4.44% | 1.11% | C: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915089225 | CA -> DEL | N | N | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> GA | LOC_Os09g25190.1 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> GA | LOC_Os09g25160.1 | downstream_gene_variant ; 2527.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> GA | LOC_Os09g25170.1 | downstream_gene_variant ; 1109.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> GA | LOC_Os09g25170-LOC_Os09g25190 | intergenic_region ; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> C | LOC_Os09g25190.1 | upstream_gene_variant ; 1437.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> C | LOC_Os09g25160.1 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> C | LOC_Os09g25170.1 | downstream_gene_variant ; 1110.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> C | LOC_Os09g25170-LOC_Os09g25190 | intergenic_region ; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGA | LOC_Os09g25190.1 | upstream_gene_variant ; 1436.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGA | LOC_Os09g25160.1 | downstream_gene_variant ; 2529.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGA | LOC_Os09g25170.1 | downstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGA | LOC_Os09g25170-LOC_Os09g25190 | intergenic_region ; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGAA | LOC_Os09g25190.1 | upstream_gene_variant ; 1436.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGAA | LOC_Os09g25160.1 | downstream_gene_variant ; 2529.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGAA | LOC_Os09g25170.1 | downstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| vg0915089225 | CA -> CAGAA | LOC_Os09g25170-LOC_Os09g25190 | intergenic_region ; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Callus, score: 80.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915089225 | NA | 9.41E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 9.97E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 1.85E-06 | mr1185_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 5.72E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 6.14E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 8.52E-07 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | NA | 2.69E-06 | mr1677_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915089225 | 4.28E-06 | 4.28E-06 | mr1912_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |