\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915088136:

Variant ID: vg0915088136 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15088136
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAGGGTGTTTGTTACCCTTGCATTTGCTCACAAGGTCACTTGGGTTGCAAGATATATTGCCACCACTTTTAATGGGTGAACTGTGTTGTGATGGTTGT[G/T]
TGATGCTGTTGGTAGTTGCCCTGTGTTCAACCTTCTTTTGCATACTCAAACAATGAACTATGAGTATTGTGTGATGGTATATGTTAGATGGTAATAGGCC

Reverse complement sequence

GGCCTATTACCATCTAACATATACCATCACACAATACTCATAGTTCATTGTTTGAGTATGCAAAAGAAGGTTGAACACAGGGCAACTACCAACAGCATCA[C/A]
ACAACCATCACAACACAGTTCACCCATTAAAAGTGGTGGCAATATATCTTGCAACCCAAGTGACCTTGTGAGCAAATGCAAGGGTAACAAACACCCTTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 35.40% 0.06% 3.07% NA
All Indica  2759 98.60% 0.90% 0.04% 0.47% NA
All Japonica  1512 1.10% 98.70% 0.00% 0.13% NA
Aus  269 49.80% 3.00% 0.00% 47.21% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 99.10% 0.20% 0.00% 0.66% NA
Indica Intermediate  786 97.70% 1.40% 0.00% 0.89% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 96.30% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 95.80% 0.00% 1.04% NA
Intermediate  90 35.60% 60.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915088136 G -> DEL N N silent_mutation Average:29.983; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0915088136 G -> T LOC_Os09g25190.1 upstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:29.983; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0915088136 G -> T LOC_Os09g25160.1 downstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:29.983; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0915088136 G -> T LOC_Os09g25170.1 downstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:29.983; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0915088136 G -> T LOC_Os09g25170-LOC_Os09g25190 intergenic_region ; MODIFIER silent_mutation Average:29.983; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915088136 NA 9.81E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 7.70E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 3.59E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 3.42E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.92E-58 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 6.87E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 2.21E-35 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 8.12E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 7.19E-42 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 3.32E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.01E-17 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 3.17E-42 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.64E-53 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 4.13E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 2.44E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.47E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 9.75E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.16E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 3.17E-06 6.19E-39 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.98E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 1.73E-25 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 8.98E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 8.27E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 2.63E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 4.96E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 2.91E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 9.30E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 1.79E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.50E-33 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 1.26E-66 mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 5.90E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 6.32E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915088136 NA 1.23E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251