Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914989973:

Variant ID: vg0914989973 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14989973
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGCAGCCGCAACAAGCAGATGGTGGGGCGCGGTGGGGAGAAGAAGAATAGGAGTGGCAGAGAGGATGAGGTGAAGGGGCGGCCGGCCGTGGTGGTGG[C/T]
AGAGCAGATGCTGCTCTCATGATTTGTGATTGTGTTCATGATTTGTGATTTTGATTTTTTTTTGGTTCATGATTGTGTTCGTGGATGAGATCTCATGGGT

Reverse complement sequence

ACCCATGAGATCTCATCCACGAACACAATCATGAACCAAAAAAAAATCAAAATCACAAATCATGAACACAATCACAAATCATGAGAGCAGCATCTGCTCT[G/A]
CCACCACCACGGCCGGCCGCCCCTTCACCTCATCCTCTCTGCCACTCCTATTCTTCTTCTCCCCACCGCGCCCCACCATCTGCTTGTTGCGGCTGCTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.30% 0.11% 0.00% NA
All Indica  2759 68.10% 31.80% 0.14% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 68.40% 31.30% 0.34% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 59.30% 40.60% 0.11% 0.00% NA
Indica Intermediate  786 68.70% 31.20% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914989973 C -> T LOC_Os09g25070.1 downstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:63.667; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0914989973 C -> T LOC_Os09g25070.2 downstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:63.667; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0914989973 C -> T LOC_Os09g25060-LOC_Os09g25070 intergenic_region ; MODIFIER silent_mutation Average:63.667; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914989973 NA 6.80E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.52E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.76E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.04E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 7.90E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.58E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.54E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 6.67E-06 6.66E-06 mr1366_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 8.91E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 9.93E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 6.22E-11 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 7.01E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 7.27E-06 7.26E-06 mr1501_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 3.02E-06 mr1505_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 6.13E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.49E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 8.43E-09 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 5.04E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.15E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.06E-07 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 5.19E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.95E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.75E-07 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 2.20E-06 2.20E-06 mr1605_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.03E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.54E-08 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.72E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 6.18E-07 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.82E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.04E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.19E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 5.43E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 6.21E-06 6.19E-06 mr1752_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 7.84E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.46E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 3.52E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 7.43E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 2.99E-07 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 9.10E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 4.29E-07 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.34E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.26E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 1.05E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 3.67E-06 3.67E-06 mr1884_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 8.85E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989973 NA 9.21E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251