\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914989711:

Variant ID: vg0914989711 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14989711
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTCCGCCTTATCTCCTCTCCCTCCACTCCCTCCGACCCCTCCACCTCTCGCCCCCCCCTGCTCCCTCCTCTCCCTCTCGCCTCCCCCGCCCCCTCGCC[G/A]
GCGGCACTCGCCCCCTCCTCCTCTCCCTCTAGTCTCCCTCCTCTCCCTCTCGCCTCCCTCCCACGGCGGATTTGGTGGTGGTGACGGCATCTTCGGCAAC

Reverse complement sequence

GTTGCCGAAGATGCCGTCACCACCACCAAATCCGCCGTGGGAGGGAGGCGAGAGGGAGAGGAGGGAGACTAGAGGGAGAGGAGGAGGGGGCGAGTGCCGC[C/T]
GGCGAGGGGGCGGGGGAGGCGAGAGGGAGAGGAGGGAGCAGGGGGGGGCGAGAGGTGGAGGGGTCGGAGGGAGTGGAGGGAGAGGAGATAAGGCGGAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 6.40% 5.97% 5.88% NA
All Indica  2759 70.70% 9.40% 10.04% 9.93% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 69.10% 8.10% 9.92% 12.94% NA
Indica II  465 94.00% 3.20% 1.08% 1.72% NA
Indica III  913 59.80% 13.90% 13.14% 13.14% NA
Indica Intermediate  786 70.70% 8.70% 11.83% 8.78% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 2.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914989711 G -> DEL N N silent_mutation Average:70.728; most accessible tissue: Minghui63 young leaf, score: 84.814 N N N N
vg0914989711 G -> A LOC_Os09g25070.1 downstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:70.728; most accessible tissue: Minghui63 young leaf, score: 84.814 N N N N
vg0914989711 G -> A LOC_Os09g25070.2 downstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:70.728; most accessible tissue: Minghui63 young leaf, score: 84.814 N N N N
vg0914989711 G -> A LOC_Os09g25060-LOC_Os09g25070 intergenic_region ; MODIFIER silent_mutation Average:70.728; most accessible tissue: Minghui63 young leaf, score: 84.814 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0914989711 G A -0.02 -0.05 -0.03 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914989711 NA 1.77E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 6.28E-06 NA mr1262_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 8.24E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 2.68E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 8.29E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 6.09E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 8.27E-07 mr1594_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 1.84E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 3.84E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 3.27E-07 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 6.68E-07 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 4.43E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 2.74E-07 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 1.95E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 9.61E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914989711 NA 8.32E-06 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251