Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914955409:

Variant ID: vg0914955409 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 14955409
Reference Allele: TA	Alternative Allele: GA,AA,T
Primary Allele: GA	Secondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACATTCGCAATGAAATTAATTATTTTTATTTCTACTTATGTATGTTGAATTGGAATTCACATGATTTGTGGAATGATATATTTCATGTTGATTTTTTTT[TA/GA,AA,T]
AAAAAAGTTTGATGATTTTTTGAGCAACATGCATAGGAGGGGATGCTCAATTAAAGGATAAAAATCCACTTTCAGATTGGTGGTAGTATCTTTGTCTGCT

Reverse complement sequence

AGCAGACAAAGATACTACCACCAATCTGAAAGTGGATTTTTATCCTTTAATTGAGCATCCCCTCCTATGCATGTTGCTCAAAAAATCATCAAACTTTTTT[TA/TC,TT,A]
AAAAAAAATCAACATGAAATATATCATTCCACAAATCATGTGAATTCCAATTCAACATACATAAGTAGAAATAAAAATAATTAATTTCATTGCGAATGTG

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of TA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	32.80%	0.49%	0.00%	T: 0.19%; AA: 0.08%
All Indica	2759	99.20%	0.80%	0.04%	0.00%	NA
All Japonica	1512	6.60%	91.40%	1.32%	0.00%	T: 0.40%; AA: 0.26%
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	11.10%	86.80%	2.09%	0.00%	NA
Tropical Japonica	504	1.00%	97.40%	0.20%	0.00%	AA: 0.79%; T: 0.60%
Japonica Intermediate	241	4.10%	93.40%	1.24%	0.00%	T: 1.24%
VI/Aromatic	96	3.10%	95.80%	1.04%	0.00%	NA
Intermediate	90	42.20%	53.30%	1.11%	0.00%	T: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0914955409	TA -> T	LOC_Os09g25030.1	upstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> T	LOC_Os09g25040.1	downstream_gene_variant ; 3957.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> T	LOC_Os09g25010-LOC_Os09g25030	intergenic_region ; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> AA	LOC_Os09g25030.1	upstream_gene_variant ; 1758.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> AA	LOC_Os09g25040.1	downstream_gene_variant ; 3958.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> AA	LOC_Os09g25010-LOC_Os09g25030	intergenic_region ; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> GA	LOC_Os09g25030.1	upstream_gene_variant ; 1758.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> GA	LOC_Os09g25040.1	downstream_gene_variant ; 3958.0bp to feature; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0914955409	TA -> GA	LOC_Os09g25010-LOC_Os09g25030	intergenic_region ; MODIFIER	silent_mutation	Average:37.739; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0914955409	NA	1.18E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	2.72E-16	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	3.18E-31	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	2.10E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	1.54E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	1.82E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	4.96E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	2.59E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	4.57E-34	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	5.85E-36	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	4.50E-27	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	1.84E-58	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	5.23E-34	mr1922	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	2.29E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	1.14E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	4.84E-16	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	9.15E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914955409	NA	1.92E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251