\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914907095:

Variant ID: vg0914907095 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14907095
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGGCACGCTTCTGGAGCTCTGCTTGGATAGATGGACGCCGACCTAAAGAACTCATGCCACTGGTCTATGCGATCTCCAAAAACAGAGGAAAGTCCCTG[T/C]
GACAAGGAAAAGATGGTGACGTATAGGTACGAGATCTGATCATTGAACCGCATTCGCCGATCACAGTCAACCTCATTGACCACAGTCGCCCTGTGGGAAG

Reverse complement sequence

CTTCCCACAGGGCGACTGTGGTCAATGAGGTTGACTGTGATCGGCGAATGCGGTTCAATGATCAGATCTCGTACCTATACGTCACCATCTTTTCCTTGTC[A/G]
CAGGGACTTTCCTCTGTTTTTGGAGATCGCATAGACCAGTGGCATGAGTTCTTTAGGTCGGCGTCCATCTATCCAAGCAGAGCTCCAGAAGCGTGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 35.50% 0.02% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914907095 T -> C LOC_Os09g24954-LOC_Os09g24965 intergenic_region ; MODIFIER silent_mutation Average:65.587; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914907095 NA 1.30E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.85E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.17E-35 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.32E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.35E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.40E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.79E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.62E-75 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 6.86E-28 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 5.55E-47 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 9.46E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 2.77E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 6.80E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 7.10E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 2.72E-17 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.63E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.33E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 7.42E-34 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 2.06E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 5.52E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.43E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.51E-88 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.47E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.07E-29 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.10E-60 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.14E-59 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 8.37E-06 NA mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.53E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.83E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 3.84E-71 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 2.82E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.98E-30 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.54E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.25E-104 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 6.95E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 5.50E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.98E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 4.63E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.29E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 8.77E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 1.46E-22 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 5.39E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 4.41E-06 NA mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 6.77E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914907095 NA 6.50E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251