\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914863853:

Variant ID: vg0914863853 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14863853
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATACACTAAAATTACATATGTAATTTTCATACTTACAACGTAAATATACTAAACTTACATATGTAATTATAGTGTAAGTACGATGTAATTAGTACGCG[T/C]
GGGATCATACGATATTCTGTGAGCGAACTTCACGTTAAATAAGGGTAAAAAAGTAACAAAAGGGTCTTATGGTGTGAACACGTTAAAGATCAGACATTGG

Reverse complement sequence

CCAATGTCTGATCTTTAACGTGTTCACACCATAAGACCCTTTTGTTACTTTTTTACCCTTATTTAACGTGAAGTTCGCTCACAGAATATCGTATGATCCC[A/G]
CGCGTACTAATTACATCGTACTTACACTATAATTACATATGTAAGTTTAGTATATTTACGTTGTAAGTATGAAAATTACATATGTAATTTTAGTGTATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 6.70% 0.49% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 79.40% 19.40% 1.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.20% 0.26% 0.00% NA
Tropical Japonica  504 46.60% 51.20% 2.18% 0.00% NA
Japonica Intermediate  241 87.10% 11.20% 1.66% 0.00% NA
VI/Aromatic  96 86.50% 10.40% 3.12% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914863853 T -> C LOC_Os09g24890.1 upstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:59.309; most accessible tissue: Minghui63 flower, score: 82.637 N N N N
vg0914863853 T -> C LOC_Os09g24900.1 upstream_gene_variant ; 3509.0bp to feature; MODIFIER silent_mutation Average:59.309; most accessible tissue: Minghui63 flower, score: 82.637 N N N N
vg0914863853 T -> C LOC_Os09g24900.2 upstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:59.309; most accessible tissue: Minghui63 flower, score: 82.637 N N N N
vg0914863853 T -> C LOC_Os09g24880.1 downstream_gene_variant ; 2667.0bp to feature; MODIFIER silent_mutation Average:59.309; most accessible tissue: Minghui63 flower, score: 82.637 N N N N
vg0914863853 T -> C LOC_Os09g24880-LOC_Os09g24890 intergenic_region ; MODIFIER silent_mutation Average:59.309; most accessible tissue: Minghui63 flower, score: 82.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914863853 NA 1.30E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 8.96E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 1.37E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 2.34E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 4.84E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 2.69E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 4.99E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 5.60E-08 mr1740 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 4.12E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 1.65E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 5.29E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 6.30E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 9.93E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 6.53E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 8.92E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 2.65E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 1.42E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 6.36E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 3.38E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 3.90E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 2.09E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 3.01E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 1.30E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 2.44E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 9.60E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914863853 NA 1.35E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251