Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914839744:

Variant ID: vg0914839744 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14839744
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTGCGACGAAGGCGGTTTCCGTGGGCGGGGGTTGCTAGGGCGCGCGTGCGCGCCAGGGAAATAGCTCGCGAGCACTCCCTCCAATTTAGTGTTAACTA[T/C]
CTATATTATATCTATATTAGTTAATATACTTAACACTTAACACTAATGATGATAATTAGGAAAAAATTCTGGAGATTTTTTTGGGAGATTTTACTAACAG

Reverse complement sequence

CTGTTAGTAAAATCTCCCAAAAAAATCTCCAGAATTTTTTCCTAATTATCATCATTAGTGTTAAGTGTTAAGTATATTAACTAATATAGATATAATATAG[A/G]
TAGTTAACACTAAATTGGAGGGAGTGCTCGCGAGCTATTTCCCTGGCGCGCACGCGCGCCCTAGCAACCCCCGCCCACGGAAACCGCCTTCGTCGCACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.20% 0.50% 0.32% 0.00% NA
All Indica  2759 99.00% 0.70% 0.33% 0.00% NA
All Japonica  1512 99.70% 0.00% 0.33% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 0.60% 0.65% 0.00% NA
Indica III  913 98.60% 1.10% 0.33% 0.00% NA
Indica Intermediate  786 99.00% 0.60% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914839744 T -> C LOC_Os09g24860.1 upstream_gene_variant ; 1329.0bp to feature; MODIFIER N Average:82.237; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0914839744 T -> C LOC_Os09g24850.1 downstream_gene_variant ; 201.0bp to feature; MODIFIER N Average:82.237; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0914839744 T -> C LOC_Os09g24870.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER N Average:82.237; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0914839744 T -> C LOC_Os09g24850-LOC_Os09g24860 intergenic_region ; MODIFIER N Average:82.237; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0914839744 T C -0.02 0.0 -0.01 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914839744 NA 4.43E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 2.29E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 2.54E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.24E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 8.85E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 9.54E-35 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.97E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 3.05E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 4.26E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.75E-38 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.83E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 7.58E-29 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.62E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.27E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 1.08E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 5.49E-20 mr1342_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914839744 NA 4.81E-20 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251