Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914831651:

Variant ID: vg0914831651 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 14831651
Reference Allele: A	Alternative Allele: T,AT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGATTTTCAATTTTTTTTGTTGAAATTAGTATGAACATGAACTGGGAATTTCAAAATTTGAGTTGGAGGTTACAAAATTTTGTCGATCATTTTTTTAAA[A/T,AT]
TTGAGATGAAAGTTTTAAAAATCAAGTTAAAGTTTAAAAAATAAAATATAATTTGAGAACAAAGTTTTGAATTTTTGAATTGAAAGTTGACTCCATTTTT

Reverse complement sequence

AAAAATGGAGTCAACTTTCAATTCAAAAATTCAAAACTTTGTTCTCAAATTATATTTTATTTTTTAAACTTTAACTTGATTTTTAAAACTTTCATCTCAA[T/A,AT]
TTTAAAAAAATGATCGACAAAATTTTGTAACCTCCAACTCAAATTTTGAAATTCCCAGTTCATGTTCATACTAATTTCAACAAAAAAAATTGAAAATCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	35.70%	0.25%	0.00%	AT: 0.02%
All Indica	2759	98.10%	1.60%	0.25%	0.00%	AT: 0.04%
All Japonica	1512	1.10%	98.70%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	99.10%	0.70%	0.11%	0.00%	AT: 0.11%
Indica Intermediate	786	97.20%	2.30%	0.51%	0.00%	NA
Temperate Japonica	767	0.90%	98.80%	0.26%	0.00%	NA
Tropical Japonica	504	0.40%	99.40%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	34.40%	63.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0914831651	A -> T	LOC_Os09g24850.1	upstream_gene_variant ; 1401.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> T	LOC_Os09g24840.1	downstream_gene_variant ; 1136.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> T	LOC_Os09g24840.2	downstream_gene_variant ; 1123.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> T	LOC_Os09g24840-LOC_Os09g24850	intergenic_region ; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> AT	LOC_Os09g24850.1	upstream_gene_variant ; 1400.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> AT	LOC_Os09g24840.1	downstream_gene_variant ; 1137.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> AT	LOC_Os09g24840.2	downstream_gene_variant ; 1124.0bp to feature; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N
vg0914831651	A -> AT	LOC_Os09g24840-LOC_Os09g24850	intergenic_region ; MODIFIER	silent_mutation	Average:54.124; most accessible tissue: Minghui63 flower, score: 69.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0914831651	NA	1.38E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	5.33E-07	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.94E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	5.63E-45	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	6.27E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	5.30E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.63E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.54E-17	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	7.83E-17	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.09E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.02E-31	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	3.22E-14	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.21E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.70E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.38E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.29E-37	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.99E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	7.83E-28	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.91E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.86E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.93E-24	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.11E-28	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	9.18E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.15E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.77E-32	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.70E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.76E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	3.90E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	7.69E-39	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.08E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.67E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	9.28E-23	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	6.07E-33	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.61E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	3.49E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	8.82E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	3.26E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	7.69E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	4.81E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	1.47E-06	4.04E-13	mr1646_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	9.88E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	4.41E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	6.28E-06	4.63E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	1.70E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	2.24E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914831651	NA	3.19E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251