\
| Variant ID: vg0914763138 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 14763138 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAATATTTCGCTACATTACATCTTTTCCTAAGATATTTGTTATAGGGTACGAGTACTACCAAGAAGGCCAACGTCAGTCCATAGACTGGAAGATCTTCTT[G/A]
GCCAGCGGCGACATTGACCTTGCCAGATAGTCTATCTCCGCCGGAGTCCTCCGAGAACGAGCAAAACCCTCACGAAGATATTCGAGGTCCAAGTGTGGGC
GCCCACACTTGGACCTCGAATATCTTCGTGAGGGTTTTGCTCGTTCTCGGAGGACTCCGGCGGAGATAGACTATCTGGCAAGGTCAATGTCGCCGCTGGC[C/T]
AAGAAGATCTTCCAGTCTATGGACTGACGTTGGCCTTCTTGGTAGTACTCGTACCCTATAACAAATATCTTAGGAAAAGATGTAATGTAGCGAAATATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 36.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 4.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914763138 | G -> A | LOC_Os09g24790.1 | synonymous_variant ; p.Ala763Ala; LOW | synonymous_codon | Average:19.323; most accessible tissue: Callus, score: 34.09 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914763138 | NA | 1.11E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 7.72E-48 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 7.13E-06 | mr1092 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 5.58E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 6.43E-45 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 3.53E-15 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 4.87E-30 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 4.91E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 9.27E-58 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 2.66E-60 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 3.22E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 1.68E-70 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914763138 | NA | 1.30E-102 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |