\
| Variant ID: vg0914741739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 14741739 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 115. )
AAGCAAAGACTGTGGAGATTTGCACCAGACCGAAAACAAGCCATACGAGAAGAGCTCGACAAACTTCTCAAAGCTGGCTTCATCAGAGAAGTACTTTATC[T/C]
AGAGTGGCTAGCCAATCCAGTCATGGTGTGGAAGGCCAACGGAAAATGGAGAATGTGTGTCGACTTCACCGACCTCAACAAGGCGTGCCCCAAGGATCAC
GTGATCCTTGGGGCACGCCTTGTTGAGGTCGGTGAAGTCGACACACATTCTCCATTTTCCGTTGGCCTTCCACACCATGACTGGATTGGCTAGCCACTCT[A/G]
GATAAAGTACTTCTCTGATGAAGCCAGCTTTGAGAAGTTTGTCGAGCTCTTCTCGTATGGCTTGTTTTCGGTCTGGTGCAAATCTCCACAGTCTTTGCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.20% | 0.40% | 57.45% | 2.94% | NA |
| All Indica | 2759 | 6.70% | 0.60% | 88.15% | 4.57% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.46% | 0.00% | NA |
| Aus | 269 | 1.10% | 0.40% | 94.42% | 4.09% | NA |
| Indica I | 595 | 3.00% | 0.30% | 84.37% | 12.27% | NA |
| Indica II | 465 | 6.90% | 1.30% | 89.03% | 2.80% | NA |
| Indica III | 913 | 8.40% | 0.10% | 90.91% | 0.55% | NA |
| Indica Intermediate | 786 | 7.30% | 1.00% | 87.28% | 4.45% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 23.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914741739 | T -> DEL | LOC_Os09g24740.1 | N | frameshift_variant | Average:33.516; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0914741739 | T -> C | LOC_Os09g24740.1 | missense_variant ; p.Leu740Pro; MODERATE | nonsynonymous_codon ; L740P | Average:33.516; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | benign |
-0.634 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914741739 | NA | 1.44E-07 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 8.49E-30 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 3.81E-28 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 6.97E-19 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 2.66E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 5.07E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 8.13E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 1.26E-14 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 2.93E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 2.88E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | 2.36E-06 | NA | mr1438_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 2.02E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914741739 | NA | 3.56E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |