\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914525816:

Variant ID: vg0914525816 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14525816
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGTGCCCGCACGATCTCCACTCCGCGTAACCGAACCGGATAAGTCGCGCGTAACTTATCCGGACTC[C/T]
ACGCCGTTTTCACGCACCGAATTTTTTGGAATGTTTCCAAAACAAAACATGCCATGCCAGGCCAGCGAGCGCGCTCGTTTGTTCCCCCTCTTCTCTCCAC

Reverse complement sequence

GTGGAGAGAAGAGGGGGAACAAACGAGCGCGCTCGCTGGCCTGGCATGGCATGTTTTGTTTTGGAAACATTCCAAAAAATTCGGTGCGTGAAAACGGCGT[G/A]
GAGTCCGGATAAGTTACGCGCGACTTATCCGGTTCGGTTACGCGGAGTGGAGATCGTGCGGGCACCCTGATCAAGCGACCTATCTCTATATAAACCGAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 18.70% 0.38% 0.49% NA
All Indica  2759 93.90% 4.90% 0.36% 0.83% NA
All Japonica  1512 52.30% 47.40% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.70% 15.80% 1.18% 3.36% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.00% 1.60% 0.11% 0.22% NA
Indica Intermediate  786 96.80% 2.80% 0.25% 0.13% NA
Temperate Japonica  767 88.80% 11.20% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 93.70% 0.40% 0.00% NA
Japonica Intermediate  241 33.20% 65.60% 1.24% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914525816 C -> DEL N N silent_mutation Average:70.836; most accessible tissue: Zhenshan97 flag leaf, score: 87.934 N N N N
vg0914525816 C -> T LOC_Os09g24420.1 upstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:70.836; most accessible tissue: Zhenshan97 flag leaf, score: 87.934 N N N N
vg0914525816 C -> T LOC_Os09g24430.1 upstream_gene_variant ; 2770.0bp to feature; MODIFIER silent_mutation Average:70.836; most accessible tissue: Zhenshan97 flag leaf, score: 87.934 N N N N
vg0914525816 C -> T LOC_Os09g24420-LOC_Os09g24430 intergenic_region ; MODIFIER silent_mutation Average:70.836; most accessible tissue: Zhenshan97 flag leaf, score: 87.934 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0914525816 C T -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914525816 NA 5.53E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 8.04E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 6.98E-06 mr1045_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 9.78E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 6.91E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 6.03E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 2.64E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 7.75E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 8.14E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 9.35E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 3.15E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 2.18E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 2.41E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 1.52E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 8.36E-08 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 3.51E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 2.56E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 5.35E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 1.96E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914525816 NA 2.30E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251