\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914518678:

Variant ID: vg0914518678 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14518678
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TCAATAGTTTGAGGGTCAAGATATCCAAGATATCCAGTATTGTGGTTTAGGGATATGAATTCAGGCACTAGTTAAGGAAGTCAAAGTGGACTTAACCCTT[C/T]
CCAAAACTATAGAGTAAATATGGCCCGTTTATAAGCAATGTAAGCCGAAATATCGGCCTTTACCATGGGCCACAATTTGAGATTACGCTTTTCGAAAAAA

Reverse complement sequence

TTTTTTCGAAAAGCGTAATCTCAAATTGTGGCCCATGGTAAAGGCCGATATTTCGGCTTACATTGCTTATAAACGGGCCATATTTACTCTATAGTTTTGG[G/A]
AAGGGTTAAGTCCACTTTGACTTCCTTAACTAGTGCCTGAATTCATATCCCTAAACCACAATACTGGATATCTTGGATATCTTGACCCTCAAACTATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.10% 0.19% 0.00% NA
All Indica  2759 26.40% 73.50% 0.18% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.13% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 31.30% 68.70% 0.00% 0.00% NA
Indica II  465 8.80% 91.00% 0.22% 0.00% NA
Indica III  913 28.50% 71.40% 0.11% 0.00% NA
Indica Intermediate  786 30.50% 69.10% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914518678 C -> T LOC_Os09g24420.1 downstream_gene_variant ; 625.0bp to feature; MODIFIER silent_mutation Average:50.266; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg0914518678 C -> T LOC_Os09g24416-LOC_Os09g24420 intergenic_region ; MODIFIER silent_mutation Average:50.266; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914518678 NA 4.74E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 2.93E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 7.09E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 3.15E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 6.43E-08 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 6.40E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.09E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.51E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 3.69E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 9.76E-06 7.87E-19 mr1454_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 7.15E-10 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.08E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 2.78E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.31E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 9.53E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 8.71E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.46E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914518678 NA 1.53E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251