\
| Variant ID: vg0914518678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 14518678 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 236. )
TCAATAGTTTGAGGGTCAAGATATCCAAGATATCCAGTATTGTGGTTTAGGGATATGAATTCAGGCACTAGTTAAGGAAGTCAAAGTGGACTTAACCCTT[C/T]
CCAAAACTATAGAGTAAATATGGCCCGTTTATAAGCAATGTAAGCCGAAATATCGGCCTTTACCATGGGCCACAATTTGAGATTACGCTTTTCGAAAAAA
TTTTTTCGAAAAGCGTAATCTCAAATTGTGGCCCATGGTAAAGGCCGATATTTCGGCTTACATTGCTTATAAACGGGCCATATTTACTCTATAGTTTTGG[G/A]
AAGGGTTAAGTCCACTTTGACTTCCTTAACTAGTGCCTGAATTCATATCCCTAAACCACAATACTGGATATCTTGGATATCTTGACCCTCAAACTATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 48.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 26.40% | 73.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 17.50% | 82.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.30% | 68.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 8.80% | 91.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 28.50% | 71.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 30.50% | 69.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914518678 | C -> T | LOC_Os09g24420.1 | downstream_gene_variant ; 625.0bp to feature; MODIFIER | silent_mutation | Average:50.266; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg0914518678 | C -> T | LOC_Os09g24416-LOC_Os09g24420 | intergenic_region ; MODIFIER | silent_mutation | Average:50.266; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914518678 | NA | 4.74E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 2.93E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 7.09E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 3.15E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 6.43E-08 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 6.40E-13 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.09E-08 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.51E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 3.69E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | 9.76E-06 | 7.87E-19 | mr1454_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 7.15E-10 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.08E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 2.78E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.31E-06 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 9.53E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 8.71E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.46E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914518678 | NA | 1.53E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |