\
| Variant ID: vg0914431217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 14431217 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 254. )
GCTCGATATCGCGAGTCATTGTTATCATATGTCTTAGTTAATCTATTCTTAGCTTCTCAATTTAGCTCTATTGGCTGCTGCTTGCTTTAGGGTTTATGCT[A/G]
GTCTCGGCTAAATTGTCTTGCTAGATTAGATTAGCTAAGGCATCTACCATCCTGAAAAGTGTTTAATTGCTTGATTGTCTATACTGTATGCTTCTTTTCA
TGAAAAGAAGCATACAGTATAGACAATCAAGCAATTAAACACTTTTCAGGATGGTAGATGCCTTAGCTAATCTAATCTAGCAAGACAATTTAGCCGAGAC[T/C]
AGCATAAACCCTAAAGCAAGCAGCAGCCAATAGAGCTAAATTGAGAAGCTAAGAATAGATTAACTAAGACATATGATAACAATGACTCGCGATATCGAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 33.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914431217 | A -> G | LOC_Os09g24290.1 | upstream_gene_variant ; 3154.0bp to feature; MODIFIER | silent_mutation | Average:41.204; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0914431217 | A -> G | LOC_Os09g24280.1 | downstream_gene_variant ; 4407.0bp to feature; MODIFIER | silent_mutation | Average:41.204; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0914431217 | A -> G | LOC_Os09g24280-LOC_Os09g24290 | intergenic_region ; MODIFIER | silent_mutation | Average:41.204; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914431217 | 4.13E-06 | 7.43E-10 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 3.12E-35 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 1.57E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 8.60E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 2.39E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 3.76E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 9.18E-30 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 4.71E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 8.51E-14 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 3.29E-08 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 1.73E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 4.53E-09 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 2.43E-37 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 9.32E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 1.84E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 1.27E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 5.17E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914431217 | NA | 7.78E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |