\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914377364:

Variant ID: vg0914377364 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14377364
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGATAGTTGGAGGAGTTGATATACCTGGTTTTGTGGTTGGAGGATATGAATCATACTCGGGCGATAGTTGAGGGACTCAAAGTATATTTTTTCCTAGT[G/A]
GTATATACTCCGTACTAGTTGTACAGCCTGTACGTTTGTTTTATTTTCTTTCCCTCTAATTCTCTTCCAAATCTAAAAATTTATTGTATATTATTTTAAT

Reverse complement sequence

ATTAAAATAATATACAATAAATTTTTAGATTTGGAAGAGAATTAGAGGGAAAGAAAATAAAACAAACGTACAGGCTGTACAACTAGTACGGAGTATATAC[C/T]
ACTAGGAAAAAATATACTTTGAGTCCCTCAACTATCGCCCGAGTATGATTCATATCCTCCAACCACAAAACCAGGTATATCAACTCCTCCAACTATCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.40% 30.20% 30.28% 5.12% NA
All Indica  2759 1.60% 44.90% 45.70% 7.83% NA
All Japonica  1512 98.90% 0.50% 0.53% 0.13% NA
Aus  269 7.10% 42.40% 42.38% 8.18% NA
Indica I  595 0.30% 33.30% 61.51% 4.87% NA
Indica II  465 3.40% 54.40% 36.56% 5.59% NA
Indica III  913 0.50% 47.10% 40.31% 12.05% NA
Indica Intermediate  786 2.70% 45.40% 45.42% 6.49% NA
Temperate Japonica  767 99.30% 0.10% 0.39% 0.13% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 1.20% 2.07% 0.41% NA
VI/Aromatic  96 17.70% 49.00% 33.33% 0.00% NA
Intermediate  90 54.40% 25.60% 17.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914377364 G -> DEL N N silent_mutation Average:65.839; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0914377364 G -> A LOC_Os09g24210.1 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:65.839; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0914377364 G -> A LOC_Os09g24220.1 upstream_gene_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:65.839; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0914377364 G -> A LOC_Os09g24210-LOC_Os09g24220 intergenic_region ; MODIFIER silent_mutation Average:65.839; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0914377364 G A 0.01 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914377364 NA 1.54E-77 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.61E-32 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.68E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 5.00E-37 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.20E-26 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.08E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 5.82E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 3.35E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.10E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 6.64E-20 mr1968 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 3.55E-101 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 5.01E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 5.27E-38 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 6.27E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.09E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.42E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.86E-63 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.08E-28 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 3.13E-38 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.23E-51 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.03E-60 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 6.37E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 2.76E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 3.30E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914377364 NA 1.80E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251