\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914238396:

Variant ID: vg0914238396 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14238396
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACATCATGTTCATGTTATACTGAATATACGGTTAGCTTATCTAGGAGATGCTTTGGTGCGGGTATAATGTTTGCATATGCAATTACTCTATGTCATGA[C/T]
GATGATATTAGAGTAGTATCTGGTAGTTTAGGCGTAGTGTCTAGATTACGGGATATCATTATTTGGGGTTATATATTGCGGATGAGAGGTGGGCCGTTGA

Reverse complement sequence

TCAACGGCCCACCTCTCATCCGCAATATATAACCCCAAATAATGATATCCCGTAATCTAGACACTACGCCTAAACTACCAGATACTACTCTAATATCATC[G/A]
TCATGACATAGAGTAATTGCATATGCAAACATTATACCCGCACCAAAGCATCTCCTAGATAAGCTAACCGTATATTCAGTATAACATGAACATGATGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 4.10% 1.10% 0.57% NA
All Indica  2759 90.30% 6.90% 1.81% 0.98% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.50% 0.34% NA
Indica II  465 86.00% 11.40% 2.15% 0.43% NA
Indica III  913 88.80% 7.00% 2.19% 1.97% NA
Indica Intermediate  786 87.90% 9.30% 2.16% 0.64% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914238396 C -> DEL N N silent_mutation Average:13.211; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0914238396 C -> T LOC_Os09g23870.1 downstream_gene_variant ; 4978.0bp to feature; MODIFIER silent_mutation Average:13.211; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0914238396 C -> T LOC_Os09g23880.1 downstream_gene_variant ; 1139.0bp to feature; MODIFIER silent_mutation Average:13.211; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0914238396 C -> T LOC_Os09g23890.1 downstream_gene_variant ; 4357.0bp to feature; MODIFIER silent_mutation Average:13.211; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0914238396 C -> T LOC_Os09g23870-LOC_Os09g23880 intergenic_region ; MODIFIER silent_mutation Average:13.211; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914238396 NA 2.26E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914238396 NA 6.83E-06 mr1742 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914238396 2.20E-06 2.20E-06 mr1808 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251