| Variant ID: vg0914211024 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 14211024 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 163. )
TTAGAATATAGTTCCTCTGACACGAGACCCTAGGTCTCCTTTGTCAGTAAACAATTATACACATGATCACATATCCGCATCTTTCAAAAGAATCCTCTTA[A/G]
AACTTGTCTGTATTACACATTTCTCCCTTATTACACGAATACAAGGCACTGCCTTAAACAAAAAGGGAAGGTGCTTATCATCGGTACATTGTATCCTCAA
TTGAGGATACAATGTACCGATGATAAGCACCTTCCCTTTTTGTTTAAGGCAGTGCCTTGTATTCGTGTAATAAGGGAGAAATGTGTAATACAGACAAGTT[T/C]
TAAGAGGATTCTTTTGAAAGATGCGGATATGTGATCATGTGTATAATTGTTTACTGACAAAGGAGACCTAGGGTCTCGTGTCAGAGGAACTATATTCTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 18.70% | 3.40% | 41.83% | 36.12% | NA |
| All Indica | 2759 | 1.80% | 3.60% | 54.08% | 40.56% | NA |
| All Japonica | 1512 | 52.80% | 2.90% | 14.55% | 29.76% | NA |
| Aus | 269 | 1.10% | 3.30% | 59.85% | 35.69% | NA |
| Indica I | 595 | 2.00% | 1.00% | 31.26% | 65.71% | NA |
| Indica II | 465 | 4.10% | 0.20% | 50.97% | 44.73% | NA |
| Indica III | 913 | 0.20% | 6.50% | 69.11% | 24.21% | NA |
| Indica Intermediate | 786 | 2.20% | 4.10% | 55.73% | 38.04% | NA |
| Temperate Japonica | 767 | 89.70% | 0.90% | 2.61% | 6.78% | NA |
| Tropical Japonica | 504 | 6.30% | 6.30% | 25.20% | 62.10% | NA |
| Japonica Intermediate | 241 | 32.40% | 2.10% | 30.29% | 35.27% | NA |
| VI/Aromatic | 96 | 2.10% | 9.40% | 66.67% | 21.88% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 44.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914211024 | A -> G | LOC_Os09g23830.1 | downstream_gene_variant ; 4636.0bp to feature; MODIFIER | silent_mutation | Average:7.955; most accessible tissue: Minghui63 flower, score: 16.206 | N | N | N | N |
| vg0914211024 | A -> G | LOC_Os09g23840.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.955; most accessible tissue: Minghui63 flower, score: 16.206 | N | N | N | N |
| vg0914211024 | A -> DEL | N | N | silent_mutation | Average:7.955; most accessible tissue: Minghui63 flower, score: 16.206 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914211024 | NA | 3.70E-22 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 6.36E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 1.82E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 5.52E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 5.76E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | 2.32E-06 | 2.15E-06 | mr1856 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 8.68E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 1.37E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 3.98E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914211024 | NA | 6.10E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |