| Variant ID: vg0913952823 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13952823 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )
AGGGACGTCACCACGCCGGTATATCATGTCTAGGAAGGTGTATGATACTCACAGGTATCACCGATGTTAGTACTCAGATCAAACAGAAGCACAGGTGCGA[C/T]
GACAAAGGCCGACCGACTCAACGTATCCTAACTGATTGGACGGTCTATTTATTTGGCCGTCAAATGGGTTGTAATTATGCATACCTGCTGCATCAGGTTT
AAACCTGATGCAGCAGGTATGCATAATTACAACCCATTTGACGGCCAAATAAATAGACCGTCCAATCAGTTAGGATACGTTGAGTCGGTCGGCCTTTGTC[G/A]
TCGCACCTGTGCTTCTGTTTGATCTGAGTACTAACATCGGTGATACCTGTGAGTATCATACACCTTCCTAGACATGATATACCGGCGTGGTGACGTCCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.70% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 88.00% | 11.20% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 10.30% | 2.35% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.80% | 15.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913952823 | C -> T | LOC_Os09g23480.1 | downstream_gene_variant ; 905.0bp to feature; MODIFIER | silent_mutation | Average:46.842; most accessible tissue: Callus, score: 71.102 | N | N | N | N |
| vg0913952823 | C -> T | LOC_Os09g23460-LOC_Os09g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:46.842; most accessible tissue: Callus, score: 71.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913952823 | NA | 7.69E-07 | mr1095 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | NA | 4.97E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | 5.83E-06 | 1.20E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | 2.67E-06 | 1.09E-09 | mr1860 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | NA | 1.53E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | NA | 4.81E-06 | mr1348_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913952823 | NA | 2.22E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |