Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0913947365:

Variant ID: vg0913947365 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 13947365
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TTATAATTAGTATTTTCATTGTTATTAGATGATAAAACATGATTAATACTTTATGCGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTCAAATAATA[C/T]
GGGCGGTTAAACGTTGGACACGGAAACCCAGGGTTTGTCTTTTTTTTTTGGAACGGAGGGAGTATACTATTACATGATATGTACCGGTTTAGAAAAAACT

Reverse complement sequence

AGTTTTTTCTAAACCGGTACATATCATGTAATAGTATACTCCCTCCGTTCCAAAAAAAAAAGACAAACCCTGGGTTTCCGTGTCCAACGTTTAACCGCCC[G/A]
TATTATTTGAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACGCATAAAGTATTAATCATGTTTTATCATCTAATAACAATGAAAATACTAATTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	8.10%	0.55%	0.00%	NA
All Indica	2759	94.80%	5.00%	0.18%	0.00%	NA
All Japonica	1512	96.40%	2.40%	1.12%	0.00%	NA
Aus	269	42.00%	57.60%	0.37%	0.00%	NA
Indica I	595	94.80%	4.70%	0.50%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	7.10%	0.25%	0.00%	NA
Temperate Japonica	767	96.90%	1.70%	1.43%	0.00%	NA
Tropical Japonica	504	95.80%	3.80%	0.40%	0.00%	NA
Japonica Intermediate	241	96.30%	2.10%	1.66%	0.00%	NA
VI/Aromatic	96	50.00%	47.90%	2.08%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913947365	C -> T	LOC_Os09g23460.1	downstream_gene_variant ; 872.0bp to feature; MODIFIER	silent_mutation	Average:32.244; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0913947365	C -> T	LOC_Os09g23460-LOC_Os09g23480	intergenic_region ; MODIFIER	silent_mutation	Average:32.244; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913947365	NA	1.42E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	3.56E-06	6.94E-09	mr1063_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	1.26E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	4.32E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	3.39E-09	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	3.95E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	6.39E-06	6.39E-06	mr1302_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	2.50E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	9.78E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	2.42E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913947365	NA	5.27E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251