\
| Variant ID: vg0913947365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13947365 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )
TTATAATTAGTATTTTCATTGTTATTAGATGATAAAACATGATTAATACTTTATGCGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTCAAATAATA[C/T]
GGGCGGTTAAACGTTGGACACGGAAACCCAGGGTTTGTCTTTTTTTTTTGGAACGGAGGGAGTATACTATTACATGATATGTACCGGTTTAGAAAAAACT
AGTTTTTTCTAAACCGGTACATATCATGTAATAGTATACTCCCTCCGTTCCAAAAAAAAAAGACAAACCCTGGGTTTCCGTGTCCAACGTTTAACCGCCC[G/A]
TATTATTTGAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACGCATAAAGTATTAATCATGTTTTATCATCTAATAACAATGAAAATACTAATTATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.10% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 2.40% | 1.12% | 0.00% | NA |
| Aus | 269 | 42.00% | 57.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.80% | 4.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 1.70% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 3.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.10% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 47.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913947365 | C -> T | LOC_Os09g23460.1 | downstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:32.244; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0913947365 | C -> T | LOC_Os09g23460-LOC_Os09g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:32.244; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913947365 | NA | 1.42E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | 3.56E-06 | 6.94E-09 | mr1063_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 1.26E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 4.32E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 3.39E-09 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 3.95E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | 6.39E-06 | 6.39E-06 | mr1302_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 2.50E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 9.78E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 2.42E-06 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913947365 | NA | 5.27E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |