\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913766899:

Variant ID: vg0913766899 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 13766899
Reference Allele: TAAlternative Allele: AA,TAA,T
Primary Allele: AASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAATACAAAAGGAGTCGTATAAGAAATCTCTTTAAGAAAAACTCGCATGGTAACTTGAGATGAAATACGAACTCCTAAATGCAGCCCATGATTTTTTT[TA/AA,TAA,T]
AAAAAATATTCATGCGAATTCCCATAGTAAATTTTACCCTAGCTAAACCGTATAGCAATAATAAAATTAAAATAGTATTTACCCGTTGTAACGCACAGAC

Reverse complement sequence

GTCTGTGCGTTACAACGGGTAAATACTATTTTAATTTTATTATTGCTATACGGTTTAGCTAGGGTAAAATTTACTATGGGAATTCGCATGAATATTTTTT[TA/TT,TTA,A]
AAAAAAATCATGGGCTGCATTTAGGAGTTCGTATTTCATCTCAAGTTACCATGCGAGTTTTTCTTAAAGAGATTTCTTATACGACTCCTTTTGTATTTTC

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 18.30% 0.61% 0.00% TAA: 0.23%; T: 0.13%
All Indica  2759 97.60% 1.80% 0.33% 0.00% TAA: 0.25%; T: 0.04%
All Japonica  1512 47.70% 51.10% 0.93% 0.00% T: 0.20%; TAA: 0.13%
Aus  269 88.10% 10.00% 1.49% 0.00% T: 0.37%
Indica I  595 98.20% 1.20% 0.17% 0.00% TAA: 0.50%
Indica II  465 97.60% 1.50% 0.43% 0.00% TAA: 0.43%
Indica III  913 98.20% 1.40% 0.22% 0.00% TAA: 0.11%
Indica Intermediate  786 96.40% 2.80% 0.51% 0.00% TAA: 0.13%; T: 0.13%
Temperate Japonica  767 9.30% 90.00% 0.65% 0.00% TAA: 0.13%
Tropical Japonica  504 95.20% 3.80% 0.99% 0.00% NA
Japonica Intermediate  241 70.50% 26.10% 1.66% 0.00% T: 1.24%; TAA: 0.41%
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 77.80% 17.80% 1.11% 0.00% TAA: 2.22%; T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913766899 TA -> T LOC_Os09g23200.1 downstream_gene_variant ; 1848.0bp to feature; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0913766899 TA -> T LOC_Os09g23200-LOC_Os09g23210 intergenic_region ; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0913766899 TA -> AA LOC_Os09g23200.1 downstream_gene_variant ; 1847.0bp to feature; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0913766899 TA -> AA LOC_Os09g23200-LOC_Os09g23210 intergenic_region ; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0913766899 TA -> TAA LOC_Os09g23200.1 downstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0913766899 TA -> TAA LOC_Os09g23200-LOC_Os09g23210 intergenic_region ; MODIFIER silent_mutation Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0913766899 TA AA 0.0 0.0 0.0 0.0 0.0 0.0
vg0913766899 TA T 0.26 0.29 0.1 0.06 0.26 0.36
vg0913766899 TA TAA 0.18 0.17 0.13 -0.03 0.14 0.26

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913766899 5.61E-07 NA mr1113 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 1.53E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 8.02E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 4.00E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 5.58E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 4.80E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 5.93E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899 NA 1.43E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251