Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913766899:

Variant ID: vg0913766899 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 13766899
Reference Allele: TA	Alternative Allele: AA,TAA,T
Primary Allele: AA	Secondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAATACAAAAGGAGTCGTATAAGAAATCTCTTTAAGAAAAACTCGCATGGTAACTTGAGATGAAATACGAACTCCTAAATGCAGCCCATGATTTTTTT[TA/AA,TAA,T]
AAAAAATATTCATGCGAATTCCCATAGTAAATTTTACCCTAGCTAAACCGTATAGCAATAATAAAATTAAAATAGTATTTACCCGTTGTAACGCACAGAC

Reverse complement sequence

GTCTGTGCGTTACAACGGGTAAATACTATTTTAATTTTATTATTGCTATACGGTTTAGCTAGGGTAAAATTTACTATGGGAATTCGCATGAATATTTTTT[TA/TT,TTA,A]
AAAAAAATCATGGGCTGCATTTAGGAGTTCGTATTTCATCTCAAGTTACCATGCGAGTTTTTCTTAAAGAGATTTCTTATACGACTCCTTTTGTATTTTC

Allele Frequencies:

Populations	Population Size	Frequency of AA(primary allele)	Frequency of TA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.70%	18.30%	0.61%	0.00%	TAA: 0.23%; T: 0.13%
All Indica	2759	97.60%	1.80%	0.33%	0.00%	TAA: 0.25%; T: 0.04%
All Japonica	1512	47.70%	51.10%	0.93%	0.00%	T: 0.20%; TAA: 0.13%
Aus	269	88.10%	10.00%	1.49%	0.00%	T: 0.37%
Indica I	595	98.20%	1.20%	0.17%	0.00%	TAA: 0.50%
Indica II	465	97.60%	1.50%	0.43%	0.00%	TAA: 0.43%
Indica III	913	98.20%	1.40%	0.22%	0.00%	TAA: 0.11%
Indica Intermediate	786	96.40%	2.80%	0.51%	0.00%	TAA: 0.13%; T: 0.13%
Temperate Japonica	767	9.30%	90.00%	0.65%	0.00%	TAA: 0.13%
Tropical Japonica	504	95.20%	3.80%	0.99%	0.00%	NA
Japonica Intermediate	241	70.50%	26.10%	1.66%	0.00%	T: 1.24%; TAA: 0.41%
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	77.80%	17.80%	1.11%	0.00%	TAA: 2.22%; T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913766899	TA -> T	LOC_Os09g23200.1	downstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0913766899	TA -> T	LOC_Os09g23200-LOC_Os09g23210	intergenic_region ; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0913766899	TA -> AA	LOC_Os09g23200.1	downstream_gene_variant ; 1847.0bp to feature; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0913766899	TA -> AA	LOC_Os09g23200-LOC_Os09g23210	intergenic_region ; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0913766899	TA -> TAA	LOC_Os09g23200.1	downstream_gene_variant ; 1849.0bp to feature; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0913766899	TA -> TAA	LOC_Os09g23200-LOC_Os09g23210	intergenic_region ; MODIFIER	silent_mutation	Average:36.526; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0913766899	TA	AA	0.0	0.0	0.0	0.0	0.0	0.0
vg0913766899	TA	T	0.26	0.29	0.1	0.06	0.26	0.36
vg0913766899	TA	TAA	0.18	0.17	0.13	-0.03	0.14	0.26

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913766899	5.61E-07	NA	mr1113	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	1.53E-06	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	8.02E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	4.00E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	5.58E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	4.80E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	5.93E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913766899	NA	1.43E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251