Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913515820:

Variant ID: vg0913515820 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 13515820
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGTACAAGTTAAGAAACAAACCCGAGATACAGATAAAGATATTCTATCTATATTCGGTATCCTATATCCAGTCTAAATATAATCGCCGTGTAGATATG[T/G,A]
GGTATCCATAATCTCCACAAGGTTGGGGTGTGTTTTATTCTATTTAGATTCGATTATTTGACTTCCGCTGACGTAATCTACCATTCACCCCCCTCTGGTT

Reverse complement sequence

AACCAGAGGGGGGTGAATGGTAGATTACGTCAGCGGAAGTCAAATAATCGAATCTAAATAGAATAAAACACACCCCAACCTTGTGGAGATTATGGATACC[A/C,T]
CATATCTACACGGCGATTATATTTAGACTGGATATAGGATACCGAATATAGATAGAATATCTTTATCTGTATCTCGGGTTTGTTTCTTAACTTGTACGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	0.30%	10.22%	28.42%	NA
All Indica	2759	44.30%	0.20%	13.99%	41.46%	NA
All Japonica	1512	92.90%	0.10%	1.79%	5.29%	NA
Aus	269	58.70%	0.70%	15.99%	24.54%	NA
Indica I	595	53.10%	0.20%	22.18%	24.54%	NA
Indica II	465	48.00%	0.00%	7.74%	44.30%	NA
Indica III	913	38.90%	0.10%	11.50%	49.51%	NA
Indica Intermediate	786	41.90%	0.50%	14.38%	43.26%	NA
Temperate Japonica	767	96.90%	0.10%	0.91%	2.09%	NA
Tropical Japonica	504	85.50%	0.00%	2.98%	11.51%	NA
Japonica Intermediate	241	95.40%	0.00%	2.07%	2.49%	NA
VI/Aromatic	96	46.90%	2.10%	18.75%	32.29%	NA
Intermediate	90	61.10%	4.40%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913515820	T -> G	LOC_Os09g22360.1	upstream_gene_variant ; 470.0bp to feature; MODIFIER	silent_mutation	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> G	LOC_Os09g22370.1	downstream_gene_variant ; 4120.0bp to feature; MODIFIER	silent_mutation	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> G	LOC_Os09g22360-LOC_Os09g22370	intergenic_region ; MODIFIER	silent_mutation	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> DEL	N	N	silent_mutation	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> A	LOC_Os09g22360.1	upstream_gene_variant ; 470.0bp to feature; MODIFIER	N	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> A	LOC_Os09g22370.1	downstream_gene_variant ; 4120.0bp to feature; MODIFIER	N	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N
vg0913515820	T -> A	LOC_Os09g22360-LOC_Os09g22370	intergenic_region ; MODIFIER	N	Average:8.834; most accessible tissue: Callus, score: 33.872	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913515820	NA	5.85E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820	NA	4.48E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820	NA	7.87E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820	NA	2.00E-11	mr1637	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820	NA	3.49E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251