\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913515820:

Variant ID: vg0913515820 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13515820
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGTACAAGTTAAGAAACAAACCCGAGATACAGATAAAGATATTCTATCTATATTCGGTATCCTATATCCAGTCTAAATATAATCGCCGTGTAGATATG[T/G,A]
GGTATCCATAATCTCCACAAGGTTGGGGTGTGTTTTATTCTATTTAGATTCGATTATTTGACTTCCGCTGACGTAATCTACCATTCACCCCCCTCTGGTT

Reverse complement sequence

AACCAGAGGGGGGTGAATGGTAGATTACGTCAGCGGAAGTCAAATAATCGAATCTAAATAGAATAAAACACACCCCAACCTTGTGGAGATTATGGATACC[A/C,T]
CATATCTACACGGCGATTATATTTAGACTGGATATAGGATACCGAATATAGATAGAATATCTTTATCTGTATCTCGGGTTTGTTTCTTAACTTGTACGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 0.30% 10.22% 28.42% NA
All Indica  2759 44.30% 0.20% 13.99% 41.46% NA
All Japonica  1512 92.90% 0.10% 1.79% 5.29% NA
Aus  269 58.70% 0.70% 15.99% 24.54% NA
Indica I  595 53.10% 0.20% 22.18% 24.54% NA
Indica II  465 48.00% 0.00% 7.74% 44.30% NA
Indica III  913 38.90% 0.10% 11.50% 49.51% NA
Indica Intermediate  786 41.90% 0.50% 14.38% 43.26% NA
Temperate Japonica  767 96.90% 0.10% 0.91% 2.09% NA
Tropical Japonica  504 85.50% 0.00% 2.98% 11.51% NA
Japonica Intermediate  241 95.40% 0.00% 2.07% 2.49% NA
VI/Aromatic  96 46.90% 2.10% 18.75% 32.29% NA
Intermediate  90 61.10% 4.40% 10.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913515820 T -> G LOC_Os09g22360.1 upstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> G LOC_Os09g22370.1 downstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> G LOC_Os09g22360-LOC_Os09g22370 intergenic_region ; MODIFIER silent_mutation Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> DEL N N silent_mutation Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> A LOC_Os09g22360.1 upstream_gene_variant ; 470.0bp to feature; MODIFIER N Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> A LOC_Os09g22370.1 downstream_gene_variant ; 4120.0bp to feature; MODIFIER N Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N
vg0913515820 T -> A LOC_Os09g22360-LOC_Os09g22370 intergenic_region ; MODIFIER N Average:8.834; most accessible tissue: Callus, score: 33.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913515820 NA 5.85E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820 NA 4.48E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820 NA 7.87E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820 NA 2.00E-11 mr1637 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913515820 NA 3.49E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251