\
| Variant ID: vg0913515820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13515820 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACGTACAAGTTAAGAAACAAACCCGAGATACAGATAAAGATATTCTATCTATATTCGGTATCCTATATCCAGTCTAAATATAATCGCCGTGTAGATATG[T/G,A]
GGTATCCATAATCTCCACAAGGTTGGGGTGTGTTTTATTCTATTTAGATTCGATTATTTGACTTCCGCTGACGTAATCTACCATTCACCCCCCTCTGGTT
AACCAGAGGGGGGTGAATGGTAGATTACGTCAGCGGAAGTCAAATAATCGAATCTAAATAGAATAAAACACACCCCAACCTTGTGGAGATTATGGATACC[A/C,T]
CATATCTACACGGCGATTATATTTAGACTGGATATAGGATACCGAATATAGATAGAATATCTTTATCTGTATCTCGGGTTTGTTTCTTAACTTGTACGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 0.30% | 10.22% | 28.42% | NA |
| All Indica | 2759 | 44.30% | 0.20% | 13.99% | 41.46% | NA |
| All Japonica | 1512 | 92.90% | 0.10% | 1.79% | 5.29% | NA |
| Aus | 269 | 58.70% | 0.70% | 15.99% | 24.54% | NA |
| Indica I | 595 | 53.10% | 0.20% | 22.18% | 24.54% | NA |
| Indica II | 465 | 48.00% | 0.00% | 7.74% | 44.30% | NA |
| Indica III | 913 | 38.90% | 0.10% | 11.50% | 49.51% | NA |
| Indica Intermediate | 786 | 41.90% | 0.50% | 14.38% | 43.26% | NA |
| Temperate Japonica | 767 | 96.90% | 0.10% | 0.91% | 2.09% | NA |
| Tropical Japonica | 504 | 85.50% | 0.00% | 2.98% | 11.51% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 2.07% | 2.49% | NA |
| VI/Aromatic | 96 | 46.90% | 2.10% | 18.75% | 32.29% | NA |
| Intermediate | 90 | 61.10% | 4.40% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913515820 | T -> G | LOC_Os09g22360.1 | upstream_gene_variant ; 470.0bp to feature; MODIFIER | silent_mutation | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> G | LOC_Os09g22370.1 | downstream_gene_variant ; 4120.0bp to feature; MODIFIER | silent_mutation | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> G | LOC_Os09g22360-LOC_Os09g22370 | intergenic_region ; MODIFIER | silent_mutation | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> DEL | N | N | silent_mutation | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> A | LOC_Os09g22360.1 | upstream_gene_variant ; 470.0bp to feature; MODIFIER | N | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> A | LOC_Os09g22370.1 | downstream_gene_variant ; 4120.0bp to feature; MODIFIER | N | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| vg0913515820 | T -> A | LOC_Os09g22360-LOC_Os09g22370 | intergenic_region ; MODIFIER | N | Average:8.834; most accessible tissue: Callus, score: 33.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913515820 | NA | 5.85E-10 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913515820 | NA | 4.48E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913515820 | NA | 7.87E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913515820 | NA | 2.00E-11 | mr1637 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913515820 | NA | 3.49E-09 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |