\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913482728:

Variant ID: vg0913482728 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13482728
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCACTCCTGAAACGCTGCTTCCCTTAGACAATTTTATGTGTAAAACGGGTGGCACCCGATTCGCCAATTGTACAGTTGTACATACTATGTAAGCCGTTC[A/G]
GCACAAAAAAAGAGGAAAATGAAAAAAGCAAAAAAGAAAAACTGGACGTAGGGTTATTATCCACCTTGGAGGCCCGAACCAATATAAAATCTTTCTATCT

Reverse complement sequence

AGATAGAAAGATTTTATATTGGTTCGGGCCTCCAAGGTGGATAATAACCCTACGTCCAGTTTTTCTTTTTTGCTTTTTTCATTTTCCTCTTTTTTTGTGC[T/C]
GAACGGCTTACATAGTATGTACAACTGTACAATTGGCGAATCGGGTGCCACCCGTTTTACACATAAAATTGTCTAAGGGAAGCAGCGTTTCAGGAGTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 13.00% 2.90% 2.86% NA
All Indica  2759 95.70% 0.70% 0.98% 2.65% NA
All Japonica  1512 58.80% 38.30% 2.91% 0.00% NA
Aus  269 58.40% 1.10% 21.93% 18.59% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 92.00% 3.00% 2.58% 2.37% NA
Indica III  913 95.20% 0.00% 0.77% 4.05% NA
Indica Intermediate  786 95.50% 0.30% 1.02% 3.18% NA
Temperate Japonica  767 27.00% 68.20% 4.82% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 19.90% 2.90% 0.00% NA
VI/Aromatic  96 82.30% 0.00% 5.21% 12.50% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913482728 A -> G LOC_Os09g22310.1 downstream_gene_variant ; 90.0bp to feature; MODIFIER silent_mutation Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0913482728 A -> G LOC_Os09g22320.1 downstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0913482728 A -> G LOC_Os09g22310-LOC_Os09g22320 intergenic_region ; MODIFIER silent_mutation Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0913482728 A -> DEL N N silent_mutation Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913482728 3.85E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728 NA 1.85E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728 NA 5.50E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728 NA 5.94E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 4.54E-07 4.62E-34 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 2.97E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 9.30E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 1.39E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 2.50E-08 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 6.48E-09 1.16E-31 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 4.09E-12 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 2.38E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 4.34E-06 1.11E-35 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 2.55E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 4.70E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 7.26E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 7.65E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 8.83E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728 NA 6.92E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251