Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913482728:

Variant ID: vg0913482728 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 13482728
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACTCCTGAAACGCTGCTTCCCTTAGACAATTTTATGTGTAAAACGGGTGGCACCCGATTCGCCAATTGTACAGTTGTACATACTATGTAAGCCGTTC[A/G]
GCACAAAAAAAGAGGAAAATGAAAAAAGCAAAAAAGAAAAACTGGACGTAGGGTTATTATCCACCTTGGAGGCCCGAACCAATATAAAATCTTTCTATCT

Reverse complement sequence

AGATAGAAAGATTTTATATTGGTTCGGGCCTCCAAGGTGGATAATAACCCTACGTCCAGTTTTTCTTTTTTGCTTTTTTCATTTTCCTCTTTTTTTGTGC[T/C]
GAACGGCTTACATAGTATGTACAACTGTACAATTGGCGAATCGGGTGCCACCCGTTTTACACATAAAATTGTCTAAGGGAAGCAGCGTTTCAGGAGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	13.00%	2.90%	2.86%	NA
All Indica	2759	95.70%	0.70%	0.98%	2.65%	NA
All Japonica	1512	58.80%	38.30%	2.91%	0.00%	NA
Aus	269	58.40%	1.10%	21.93%	18.59%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	92.00%	3.00%	2.58%	2.37%	NA
Indica III	913	95.20%	0.00%	0.77%	4.05%	NA
Indica Intermediate	786	95.50%	0.30%	1.02%	3.18%	NA
Temperate Japonica	767	27.00%	68.20%	4.82%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	19.90%	2.90%	0.00%	NA
VI/Aromatic	96	82.30%	0.00%	5.21%	12.50%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913482728	A -> G	LOC_Os09g22310.1	downstream_gene_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0913482728	A -> G	LOC_Os09g22320.1	downstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0913482728	A -> G	LOC_Os09g22310-LOC_Os09g22320	intergenic_region ; MODIFIER	silent_mutation	Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0913482728	A -> DEL	N	N	silent_mutation	Average:54.572; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913482728	3.85E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728	NA	1.85E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728	NA	5.50E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913482728	NA	5.94E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	4.54E-07	4.62E-34	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	2.97E-12	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	9.30E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	1.39E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	2.50E-08	mr1530	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	6.48E-09	1.16E-31	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	4.09E-12	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	2.38E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	4.34E-06	1.11E-35	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	2.55E-11	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	4.70E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	7.26E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	7.65E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	8.83E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913482728	NA	6.92E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251