\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913444404:

Variant ID: vg0913444404 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13444404
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTCTCCTTGAGCCGATTCTAACTTCCCAAGGCAAAACAGCCTCGTGCCCAAAAACAAGCTTATAAGGAGGAACTTGGATTGAACCATGACAAGCCAT[C/T]
CGATAGGACCACAATGCTTCGGCCAATCTAGTATGCCACTGCCGAGGATAATCGGAAATCTTTCTCTTAATCAATTTGATCAAACTCTTGTTAGATGCCT

Reverse complement sequence

AGGCATCTAACAAGAGTTTGATCAAATTGATTAAGAGAAAGATTTCCGATTATCCTCGGCAGTGGCATACTAGATTGGCCGAAGCATTGTGGTCCTATCG[G/A]
ATGGCTTGTCATGGTTCAATCCAAGTTCCTCCTTATAAGCTTGTTTTTGGGCACGAGGCTGTTTTGCCTTGGGAAGTTAGAATCGGCTCAAGGAGAACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 0.90% 2.12% 0.74% NA
All Indica  2759 99.90% 0.00% 0.04% 0.04% NA
All Japonica  1512 94.20% 2.70% 3.11% 0.00% NA
Aus  269 73.20% 0.00% 16.73% 10.04% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.13% 0.13% NA
Temperate Japonica  767 95.80% 1.70% 2.48% 0.00% NA
Tropical Japonica  504 98.20% 0.20% 1.59% 0.00% NA
Japonica Intermediate  241 80.50% 11.20% 8.30% 0.00% NA
VI/Aromatic  96 86.50% 0.00% 6.25% 7.29% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913444404 C -> DEL LOC_Os09g22230.1 N frameshift_variant Average:32.896; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0913444404 C -> T LOC_Os09g22230.1 synonymous_variant ; p.Arg1511Arg; LOW synonymous_codon Average:32.896; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913444404 2.49E-07 1.27E-08 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 5.11E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 4.33E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 9.69E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 4.70E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 1.57E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 2.65E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913444404 NA 9.52E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251