\
| Variant ID: vg0913444404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13444404 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGTTCTCCTTGAGCCGATTCTAACTTCCCAAGGCAAAACAGCCTCGTGCCCAAAAACAAGCTTATAAGGAGGAACTTGGATTGAACCATGACAAGCCAT[C/T]
CGATAGGACCACAATGCTTCGGCCAATCTAGTATGCCACTGCCGAGGATAATCGGAAATCTTTCTCTTAATCAATTTGATCAAACTCTTGTTAGATGCCT
AGGCATCTAACAAGAGTTTGATCAAATTGATTAAGAGAAAGATTTCCGATTATCCTCGGCAGTGGCATACTAGATTGGCCGAAGCATTGTGGTCCTATCG[G/A]
ATGGCTTGTCATGGTTCAATCCAAGTTCCTCCTTATAAGCTTGTTTTTGGGCACGAGGCTGTTTTGCCTTGGGAAGTTAGAATCGGCTCAAGGAGAACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.30% | 0.90% | 2.12% | 0.74% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 94.20% | 2.70% | 3.11% | 0.00% | NA |
| Aus | 269 | 73.20% | 0.00% | 16.73% | 10.04% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 95.80% | 1.70% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 0.20% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 11.20% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 6.25% | 7.29% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913444404 | C -> DEL | LOC_Os09g22230.1 | N | frameshift_variant | Average:32.896; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0913444404 | C -> T | LOC_Os09g22230.1 | synonymous_variant ; p.Arg1511Arg; LOW | synonymous_codon | Average:32.896; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913444404 | 2.49E-07 | 1.27E-08 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 5.11E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 4.33E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 9.69E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 4.70E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 1.57E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 2.65E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913444404 | NA | 9.52E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |