\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913424446:

Variant ID: vg0913424446 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13424446
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGTACAACGTCAGTGCGCCGGTGGACATCTGTGACGGCATACCTCTGATGGGCCTATGAACTGGTCAGAGATGACCGTCACCTTTGACGGGTCGCTAG[T/G]
TTTGCCGTTATCGGTGGGGAATTCGGCCGCGACCCGTCATAGGTATCCCATCACCTGTGACGGGCCGGAAGGAAAAGCCGTCATAGGTATACCAGTGACG

Reverse complement sequence

CGTCACTGGTATACCTATGACGGCTTTTCCTTCCGGCCCGTCACAGGTGATGGGATACCTATGACGGGTCGCGGCCGAATTCCCCACCGATAACGGCAAA[A/C]
CTAGCGACCCGTCAAAGGTGACGGTCATCTCTGACCAGTTCATAGGCCCATCAGAGGTATGCCGTCACAGATGTCCACCGGCGCACTGACGTTGTACGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 12.30% 10.56% 7.72% NA
All Indica  2759 95.10% 0.30% 0.25% 4.31% NA
All Japonica  1512 24.80% 36.70% 31.88% 6.61% NA
Aus  269 53.50% 0.40% 0.00% 46.10% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.90% 1.10% 0.43% 8.60% NA
Indica III  913 95.00% 0.00% 0.11% 4.93% NA
Indica Intermediate  786 94.90% 0.30% 0.51% 4.33% NA
Temperate Japonica  767 16.90% 66.10% 16.69% 0.26% NA
Tropical Japonica  504 34.50% 1.60% 48.41% 15.48% NA
Japonica Intermediate  241 29.50% 16.60% 45.64% 8.30% NA
VI/Aromatic  96 81.20% 0.00% 0.00% 18.75% NA
Intermediate  90 67.80% 16.70% 11.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913424446 T -> G LOC_Os09g22170.1 upstream_gene_variant ; 3907.0bp to feature; MODIFIER silent_mutation Average:78.729; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N
vg0913424446 T -> G LOC_Os09g22200.1 upstream_gene_variant ; 3359.0bp to feature; MODIFIER silent_mutation Average:78.729; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N
vg0913424446 T -> G LOC_Os09g22190.1 intron_variant ; MODIFIER silent_mutation Average:78.729; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N
vg0913424446 T -> DEL N N silent_mutation Average:78.729; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0913424446 T G 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913424446 NA 2.93E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913424446 NA 2.59E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0913424446 4.39E-06 2.10E-35 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 3.99E-14 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 7.82E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 4.16E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 1.31E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 2.77E-08 4.20E-33 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 8.11E-14 mr1617 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 2.72E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 7.73E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 5.80E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 9.28E-09 2.29E-42 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 9.02E-15 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 4.93E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 8.71E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 1.54E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 1.40E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 3.59E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 3.51E-07 1.28E-29 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 2.06E-10 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 3.29E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 4.08E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913424446 NA 6.13E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251