\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913244556:

Variant ID: vg0913244556 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13244556
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GACTCCAATTCTTTGTGCTTGGCCTCCAAGAGGATGCTCTTGTCCACTAGACGTTGGAAATCCGGATAGTCCCCGGACACCAGACGTACGGACAGCTCAG[A/G]
GTCCATTCCCGCCAAGAACTTCTCTTGCTTTTCCTCATCTTCCCGAACGTCCTCCGGGGCGTACCGGGCCAGGTTGTTAAACTCATGCAAATACTCCATC

Reverse complement sequence

GATGGAGTATTTGCATGAGTTTAACAACCTGGCCCGGTACGCCCCGGAGGACGTTCGGGAAGATGAGGAAAAGCAAGAGAAGTTCTTGGCGGGAATGGAC[T/C]
CTGAGCTGTCCGTACGTCTGGTGTCCGGGGACTATCCGGATTTCCAACGTCTAGTGGACAAGAGCATCCTCTTGGAGGCCAAGCACAAAGAATTGGAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 18.50% 1.14% 11.40% NA
All Indica  2759 97.40% 0.60% 0.14% 1.81% NA
All Japonica  1512 10.20% 55.30% 3.11% 31.42% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 95.70% 2.40% 0.22% 1.72% NA
Indica III  913 96.50% 0.10% 0.00% 3.40% NA
Indica Intermediate  786 98.00% 0.30% 0.38% 1.40% NA
Temperate Japonica  767 5.70% 89.40% 0.65% 4.17% NA
Tropical Japonica  504 18.30% 10.50% 6.35% 64.88% NA
Japonica Intermediate  241 7.50% 40.20% 4.15% 48.13% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 58.90% 22.20% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913244556 A -> G LOC_Os09g21860.1 missense_variant ; p.Ser221Pro; MODERATE nonsynonymous_codon ; S221P Average:80.663; most accessible tissue: Minghui63 flag leaf, score: 95.215 benign -0.638 TOLERATED 1.00
vg0913244556 A -> DEL LOC_Os09g21860.1 N frameshift_variant Average:80.663; most accessible tissue: Minghui63 flag leaf, score: 95.215 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0913244556 A G 0.01 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913244556 NA 3.29E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 5.36E-40 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 1.08E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 2.70E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 4.67E-06 4.67E-06 mr1621 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 1.00E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 2.15E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 4.52E-18 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913244556 NA 8.70E-18 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251