Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913096920:

Variant ID: vg0913096920 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 13096920
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAACCAACTGTACAGTTTGTATGTAAATTGCGAGACAAATCTTTTGAGTCTAATTACGCCATGATTTAACAATGTGGTGCTACAGTAAACATTTGC[A/T]
AATGATGGATTAATTAGGCTTAATAGATTCGTCTCGCAGTTTACAAGCGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATGTGT

Reverse complement sequence

ACACATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCGCTTGTAAACTGCGAGACGAATCTATTAAGCCTAATTAATCCATCATT[T/A]
GCAAATGTTTACTGTAGCACCACATTGTTAAATCATGGCGTAATTAGACTCAAAAGATTTGTCTCGCAATTTACATACAAACTGTACAGTTGGTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	0.20%	0.72%	16.14%	NA
All Indica	2759	99.60%	0.00%	0.11%	0.33%	NA
All Japonica	1512	52.60%	0.50%	0.46%	46.43%	NA
Aus	269	79.90%	0.00%	8.55%	11.52%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	99.60%	0.00%	0.11%	0.33%	NA
Indica Intermediate	786	99.10%	0.00%	0.25%	0.64%	NA
Temperate Japonica	767	81.00%	0.00%	0.00%	19.04%	NA
Tropical Japonica	504	21.80%	1.60%	0.99%	75.60%	NA
Japonica Intermediate	241	26.60%	0.00%	0.83%	72.61%	NA
VI/Aromatic	96	87.50%	0.00%	1.04%	11.46%	NA
Intermediate	90	88.90%	0.00%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913096920	A -> DEL	N	N	silent_mutation	Average:35.837; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0913096920	A -> T	LOC_Os09g21630.1	downstream_gene_variant ; 2524.0bp to feature; MODIFIER	silent_mutation	Average:35.837; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0913096920	A -> T	LOC_Os09g21620-LOC_Os09g21630	intergenic_region ; MODIFIER	silent_mutation	Average:35.837; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913096920	NA	4.04E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	6.37E-07	6.37E-07	mr1914	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	5.63E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	3.64E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	7.42E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	6.46E-08	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	8.31E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	6.53E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913096920	NA	2.45E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251