\
| Variant ID: vg0913080857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13080857 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGTTATAAATCGTCAGAAAGAAGATGAGGAAGTGTGCCAGCTGAAGAAAGCACTTGGAGAAGCCACTCGCATTGTAAATGTAAGTCTTCTAGGTAACTGC[C/T]
TTTGATGACTTTATTGTCTCGTTAGCAAAACTAATCCATGAACCACCATGCAGAGGATCCATCTTCGCAATGAGGCCAAGACCACAACCTTAGAAAAGCT
AGCTTTTCTAAGGTTGTGGTCTTGGCCTCATTGCGAAGATGGATCCTCTGCATGGTGGTTCATGGATTAGTTTTGCTAACGAGACAATAAAGTCATCAAA[G/A]
GCAGTTACCTAGAAGACTTACATTTACAATGCGAGTGGCTTCTCCAAGTGCTTTCTTCAGCTGGCACACTTCCTCATCTTCTTTCTGACGATTTATAACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 31.00% | 18.75% | 0.76% | NA |
| All Indica | 2759 | 51.00% | 22.30% | 26.21% | 0.51% | NA |
| All Japonica | 1512 | 48.70% | 46.60% | 3.31% | 1.32% | NA |
| Aus | 269 | 31.60% | 40.10% | 28.25% | 0.00% | NA |
| Indica I | 595 | 50.60% | 9.40% | 39.33% | 0.67% | NA |
| Indica II | 465 | 51.60% | 19.80% | 28.17% | 0.43% | NA |
| Indica III | 913 | 53.90% | 29.20% | 16.32% | 0.55% | NA |
| Indica Intermediate | 786 | 47.60% | 25.40% | 26.59% | 0.38% | NA |
| Temperate Japonica | 767 | 17.60% | 77.30% | 3.26% | 1.83% | NA |
| Tropical Japonica | 504 | 90.10% | 6.20% | 3.37% | 0.40% | NA |
| Japonica Intermediate | 241 | 61.40% | 33.60% | 3.32% | 1.66% | NA |
| VI/Aromatic | 96 | 74.00% | 4.20% | 21.88% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 34.40% | 17.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913080857 | C -> DEL | N | N | silent_mutation | Average:8.76; most accessible tissue: Zhenshan97 young leaf, score: 22.751 | N | N | N | N |
| vg0913080857 | C -> T | LOC_Os09g21610.1 | downstream_gene_variant ; 1258.0bp to feature; MODIFIER | silent_mutation | Average:8.76; most accessible tissue: Zhenshan97 young leaf, score: 22.751 | N | N | N | N |
| vg0913080857 | C -> T | LOC_Os09g21600.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.76; most accessible tissue: Zhenshan97 young leaf, score: 22.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913080857 | NA | 8.94E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 1.33E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 7.46E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 3.08E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 1.73E-10 | mr1551_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 1.34E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 5.64E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080857 | NA | 1.30E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |