\
| Variant ID: vg0913080416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13080416 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTGGCGCCCATGCTTCGGATGACAAGGCCAATCCGAGTGACCAGCCGCCGACTGGAAACCAGTCGGCAACAACTGAAACTGCAACAACCCGAGAGCCCCC[A/G]
ACTAGAAACCAGTCGGATGTAGGTCTTGATCAAGAAATCCCTGAAGTTGAAGCGCAAGCGACAGCTTCTCAAGGACCAGAGGCTGGAAATGACTCGATGA
TCATCGAGTCATTTCCAGCCTCTGGTCCTTGAGAAGCTGTCGCTTGCGCTTCAACTTCAGGGATTTCTTGATCAAGACCTACATCCGACTGGTTTCTAGT[T/C]
GGGGGCTCTCGGGTTGTTGCAGTTTCAGTTGTTGCCGACTGGTTTCCAGTCGGCGGCTGGTCACTCGGATTGGCCTTGTCATCCGAAGCATGGGCGCCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 7.10% | 34.38% | 20.69% | NA |
| All Indica | 2759 | 29.80% | 0.30% | 35.92% | 33.96% | NA |
| All Japonica | 1512 | 53.80% | 20.60% | 24.67% | 0.93% | NA |
| Aus | 269 | 21.90% | 1.50% | 72.12% | 4.46% | NA |
| Indica I | 595 | 26.10% | 0.00% | 37.14% | 36.81% | NA |
| Indica II | 465 | 31.60% | 0.20% | 31.61% | 36.56% | NA |
| Indica III | 913 | 28.60% | 0.20% | 37.68% | 33.52% | NA |
| Indica Intermediate | 786 | 33.10% | 0.60% | 35.50% | 30.79% | NA |
| Temperate Japonica | 767 | 82.40% | 3.50% | 12.91% | 1.17% | NA |
| Tropical Japonica | 504 | 17.90% | 51.20% | 29.96% | 0.99% | NA |
| Japonica Intermediate | 241 | 37.80% | 11.20% | 51.04% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 0.00% | 43.75% | 6.25% | NA |
| Intermediate | 90 | 51.10% | 11.10% | 27.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913080416 | A -> G | LOC_Os09g21600.1 | synonymous_variant ; p.Pro470Pro; LOW | synonymous_codon | Average:34.794; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0913080416 | A -> DEL | LOC_Os09g21600.1 | N | frameshift_variant | Average:34.794; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913080416 | 6.13E-07 | NA | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | 4.55E-06 | NA | mr1007 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | 4.51E-07 | NA | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | NA | 2.29E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | NA | 6.52E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | 3.33E-06 | NA | mr1565 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | 4.49E-06 | 4.49E-06 | mr1126_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913080416 | 1.43E-06 | 3.19E-06 | mr1127_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |