\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912946767:

Variant ID: vg0912946767 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12946767
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCATTGTGACCAATTCCTAAAATAGTATTTCTCCTTTGTTTTATGTGCGCAAGACTAAAAAACACTTAATTTTTAATCGATCCGGTCTAGACAGACCA[G/A]
ACAGATTCCGAGCGTAACCAATTTTATCCTAAAATAATATTTCTCCTTTATTCTATATGCGCACGAGCGAAAAACCACGTGTTTTTTAATTGACCCAGTC

Reverse complement sequence

GACTGGGTCAATTAAAAAACACGTGGTTTTTCGCTCGTGCGCATATAGAATAAAGGAGAAATATTATTTTAGGATAAAATTGGTTACGCTCGGAATCTGT[C/T]
TGGTCTGTCTAGACCGGATCGATTAAAAATTAAGTGTTTTTTAGTCTTGCGCACATAAAACAAAGGAGAAATACTATTTTAGGAATTGGTCACAATGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 1.30% 3.72% 12.31% NA
All Indica  2759 76.40% 2.20% 6.02% 15.30% NA
All Japonica  1512 96.00% 0.00% 0.53% 3.44% NA
Aus  269 92.60% 0.00% 0.37% 7.06% NA
Indica I  595 62.70% 5.50% 15.80% 15.97% NA
Indica II  465 75.30% 1.10% 4.09% 19.57% NA
Indica III  913 86.70% 0.10% 1.31% 11.83% NA
Indica Intermediate  786 75.60% 2.90% 5.22% 16.28% NA
Temperate Japonica  767 98.00% 0.00% 0.39% 1.56% NA
Tropical Japonica  504 92.50% 0.00% 0.99% 6.55% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 22.90% 0.00% 0.00% 77.08% NA
Intermediate  90 82.20% 0.00% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912946767 G -> DEL N N silent_mutation Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg0912946767 G -> A LOC_Os09g21420.1 upstream_gene_variant ; 2260.0bp to feature; MODIFIER silent_mutation Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg0912946767 G -> A LOC_Os09g21430.1 downstream_gene_variant ; 4376.0bp to feature; MODIFIER silent_mutation Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg0912946767 G -> A LOC_Os09g21420-LOC_Os09g21430 intergenic_region ; MODIFIER silent_mutation Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912946767 NA 4.96E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0912946767 NA 5.82E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767 NA 1.39E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767 2.43E-06 NA mr1865 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767 4.51E-07 2.66E-08 mr1865 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767 NA 2.31E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767 NA 5.21E-08 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251