Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912946767:

Variant ID: vg0912946767 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12946767
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCATTGTGACCAATTCCTAAAATAGTATTTCTCCTTTGTTTTATGTGCGCAAGACTAAAAAACACTTAATTTTTAATCGATCCGGTCTAGACAGACCA[G/A]
ACAGATTCCGAGCGTAACCAATTTTATCCTAAAATAATATTTCTCCTTTATTCTATATGCGCACGAGCGAAAAACCACGTGTTTTTTAATTGACCCAGTC

Reverse complement sequence

GACTGGGTCAATTAAAAAACACGTGGTTTTTCGCTCGTGCGCATATAGAATAAAGGAGAAATATTATTTTAGGATAAAATTGGTTACGCTCGGAATCTGT[C/T]
TGGTCTGTCTAGACCGGATCGATTAAAAATTAAGTGTTTTTTAGTCTTGCGCACATAAAACAAAGGAGAAATACTATTTTAGGAATTGGTCACAATGCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	1.30%	3.72%	12.31%	NA
All Indica	2759	76.40%	2.20%	6.02%	15.30%	NA
All Japonica	1512	96.00%	0.00%	0.53%	3.44%	NA
Aus	269	92.60%	0.00%	0.37%	7.06%	NA
Indica I	595	62.70%	5.50%	15.80%	15.97%	NA
Indica II	465	75.30%	1.10%	4.09%	19.57%	NA
Indica III	913	86.70%	0.10%	1.31%	11.83%	NA
Indica Intermediate	786	75.60%	2.90%	5.22%	16.28%	NA
Temperate Japonica	767	98.00%	0.00%	0.39%	1.56%	NA
Tropical Japonica	504	92.50%	0.00%	0.99%	6.55%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	22.90%	0.00%	0.00%	77.08%	NA
Intermediate	90	82.20%	0.00%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912946767	G -> DEL	N	N	silent_mutation	Average:15.621; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg0912946767	G -> A	LOC_Os09g21420.1	upstream_gene_variant ; 2260.0bp to feature; MODIFIER	silent_mutation	Average:15.621; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg0912946767	G -> A	LOC_Os09g21430.1	downstream_gene_variant ; 4376.0bp to feature; MODIFIER	silent_mutation	Average:15.621; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg0912946767	G -> A	LOC_Os09g21420-LOC_Os09g21430	intergenic_region ; MODIFIER	silent_mutation	Average:15.621; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912946767	NA	4.96E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0912946767	NA	5.82E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767	NA	1.39E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767	2.43E-06	NA	mr1865	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767	4.51E-07	2.66E-08	mr1865	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767	NA	2.31E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912946767	NA	5.21E-08	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251