\
| Variant ID: vg0912946767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12946767 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGCATTGTGACCAATTCCTAAAATAGTATTTCTCCTTTGTTTTATGTGCGCAAGACTAAAAAACACTTAATTTTTAATCGATCCGGTCTAGACAGACCA[G/A]
ACAGATTCCGAGCGTAACCAATTTTATCCTAAAATAATATTTCTCCTTTATTCTATATGCGCACGAGCGAAAAACCACGTGTTTTTTAATTGACCCAGTC
GACTGGGTCAATTAAAAAACACGTGGTTTTTCGCTCGTGCGCATATAGAATAAAGGAGAAATATTATTTTAGGATAAAATTGGTTACGCTCGGAATCTGT[C/T]
TGGTCTGTCTAGACCGGATCGATTAAAAATTAAGTGTTTTTTAGTCTTGCGCACATAAAACAAAGGAGAAATACTATTTTAGGAATTGGTCACAATGCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 1.30% | 3.72% | 12.31% | NA |
| All Indica | 2759 | 76.40% | 2.20% | 6.02% | 15.30% | NA |
| All Japonica | 1512 | 96.00% | 0.00% | 0.53% | 3.44% | NA |
| Aus | 269 | 92.60% | 0.00% | 0.37% | 7.06% | NA |
| Indica I | 595 | 62.70% | 5.50% | 15.80% | 15.97% | NA |
| Indica II | 465 | 75.30% | 1.10% | 4.09% | 19.57% | NA |
| Indica III | 913 | 86.70% | 0.10% | 1.31% | 11.83% | NA |
| Indica Intermediate | 786 | 75.60% | 2.90% | 5.22% | 16.28% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.39% | 1.56% | NA |
| Tropical Japonica | 504 | 92.50% | 0.00% | 0.99% | 6.55% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 22.90% | 0.00% | 0.00% | 77.08% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 1.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912946767 | G -> DEL | N | N | silent_mutation | Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0912946767 | G -> A | LOC_Os09g21420.1 | upstream_gene_variant ; 2260.0bp to feature; MODIFIER | silent_mutation | Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0912946767 | G -> A | LOC_Os09g21430.1 | downstream_gene_variant ; 4376.0bp to feature; MODIFIER | silent_mutation | Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0912946767 | G -> A | LOC_Os09g21420-LOC_Os09g21430 | intergenic_region ; MODIFIER | silent_mutation | Average:15.621; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912946767 | NA | 4.96E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0912946767 | NA | 5.82E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912946767 | NA | 1.39E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912946767 | 2.43E-06 | NA | mr1865 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912946767 | 4.51E-07 | 2.66E-08 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912946767 | NA | 2.31E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912946767 | NA | 5.21E-08 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |