Variant ID: vg0912905423 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 12905423 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACGTACGTATAGAGGGAGCGGGCCCAGCGATCACCAGCACATTAGCAGTCCCCCTTATACGGTCCTACCACTTAATCATGTACGAGCCACACAACACAG[G/A]
AACACAGCAGAGATTAGAGGCCAAGGAAGCATCGGAGCGAGGTGATCATTGACGCGCAATTAAACAAGCGTAGAAAACCGGGACGTTTGGGCGGCCGCCA
TGGCGGCCGCCCAAACGTCCCGGTTTTCTACGCTTGTTTAATTGCGCGTCAATGATCACCTCGCTCCGATGCTTCCTTGGCCTCTAATCTCTGCTGTGTT[C/T]
CTGTGTTGTGTGGCTCGTACATGATTAAGTGGTAGGACCGTATAAGGGGGACTGCTAATGTGCTGGTGATCGCTGGGCCCGCTCCCTCTATACGTACGTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
All Indica | 2759 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 45.70% | 54.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0912905423 | G -> A | LOC_Os09g21370-LOC_Os09g21380 | intergenic_region ; MODIFIER | silent_mutation | Average:76.231; most accessible tissue: Callus, score: 97.342 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0912905423 | NA | 6.68E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 6.43E-06 | mr1099_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 7.18E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 8.30E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 1.87E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 7.94E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 8.81E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912905423 | NA | 9.69E-08 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |