Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0912905423:

Variant ID: vg0912905423 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12905423
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGTACGTATAGAGGGAGCGGGCCCAGCGATCACCAGCACATTAGCAGTCCCCCTTATACGGTCCTACCACTTAATCATGTACGAGCCACACAACACAG[G/A]
AACACAGCAGAGATTAGAGGCCAAGGAAGCATCGGAGCGAGGTGATCATTGACGCGCAATTAAACAAGCGTAGAAAACCGGGACGTTTGGGCGGCCGCCA

Reverse complement sequence

TGGCGGCCGCCCAAACGTCCCGGTTTTCTACGCTTGTTTAATTGCGCGTCAATGATCACCTCGCTCCGATGCTTCCTTGGCCTCTAATCTCTGCTGTGTT[C/T]
CTGTGTTGTGTGGCTCGTACATGATTAAGTGGTAGGACCGTATAAGGGGGACTGCTAATGTGCTGGTGATCGCTGGGCCCGCTCCCTCTATACGTACGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.60% 0.00% 0.00% NA
All Indica  2759 93.50% 6.50% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 89.90% 10.10% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912905423 G -> A LOC_Os09g21370-LOC_Os09g21380 intergenic_region ; MODIFIER silent_mutation Average:76.231; most accessible tissue: Callus, score: 97.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912905423 NA 6.68E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 6.43E-06 mr1099_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 7.18E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 8.30E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 1.87E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 7.94E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 8.81E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912905423 NA 9.69E-08 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251