\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912892254:

Variant ID: vg0912892254 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12892254
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GGTAATCCTTCAAGAGCGCCGGCGCTTCTTTCTTCGGAAGAAGGATGATCACAGCCGAATTCAATCTCTCAAGGTTTTGCGAATTGCCGGAGAAGAATTT[C/A]
TGGAGGGCTGCTAAGACATCACACTTGATTGTATCCCAGCAAGCTTGATAGAAAAGCCCTGTGAAACCGTCCGGGCCAGGAGCTTTTTCAGCCGGCATGT

Reverse complement sequence

ACATGCCGGCTGAAAAAGCTCCTGGCCCGGACGGTTTCACAGGGCTTTTCTATCAAGCTTGCTGGGATACAATCAAGTGTGATGTCTTAGCAGCCCTCCA[G/T]
AAATTCTTCTCCGGCAATTCGCAAAACCTTGAGAGATTGAATTCGGCTGTGATCATCCTTCTTCCGAAGAAAGAAGCGCCGGCGCTCTTGAAGGATTACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 42.70% 0.34% 0.00% NA
All Indica  2759 88.70% 10.90% 0.40% 0.00% NA
All Japonica  1512 6.90% 92.90% 0.20% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 85.00% 14.60% 0.34% 0.00% NA
Indica II  465 95.30% 4.30% 0.43% 0.00% NA
Indica III  913 88.40% 11.40% 0.22% 0.00% NA
Indica Intermediate  786 88.00% 11.30% 0.64% 0.00% NA
Temperate Japonica  767 2.20% 97.70% 0.13% 0.00% NA
Tropical Japonica  504 15.70% 83.90% 0.40% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 28.90% 68.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912892254 C -> A LOC_Os09g21350.1 missense_variant ; p.Gln76His; MODERATE nonsynonymous_codon ; Q76H Average:85.819; most accessible tissue: Zhenshan97 flower, score: 93.254 benign -1.193 TOLERATED 0.65

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0912892254 C A -0.02 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912892254 NA 6.45E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 2.80E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 3.62E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 1.44E-13 mr1751 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 4.98E-07 mr1751 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 6.05E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 4.15E-07 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 6.76E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 9.37E-28 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 1.97E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912892254 NA 1.00E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251