Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912864929:

Variant ID: vg0912864929 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12864929
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATAATGGTATGATCCAAATTCACAAATACTGATGGCATATTTTAAAACTGGCATATTTTTAATGGCAATGTATCTAATTAACCCTATCCTATATAGGG[C/T]
GCGTTCTTAATTCTTCATCAAGCATATATATGCATGTGAAACTGACACTGAAGATATAAATTAAATGTTAACAATGTTTCTAGAATTTACGGACGTTGAT

Reverse complement sequence

ATCAACGTCCGTAAATTCTAGAAACATTGTTAACATTTAATTTATATCTTCAGTGTCAGTTTCACATGCATATATATGCTTGATGAAGAATTAAGAACGC[G/A]
CCCTATATAGGATAGGGTTAATTAGATACATTGCCATTAAAAATATGCCAGTTTTAAAATATGCCATCAGTATTTGTGAATTTGGATCATACCATTATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	33.70%	0.13%	0.17%	NA
All Indica	2759	96.50%	3.00%	0.18%	0.29%	NA
All Japonica	1512	7.60%	92.30%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	96.80%	1.80%	0.34%	1.01%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	96.60%	3.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.70%	0.25%	0.25%	NA
Temperate Japonica	767	3.30%	96.60%	0.13%	0.00%	NA
Tropical Japonica	504	15.70%	84.30%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912864929	C -> DEL	N	N	silent_mutation	Average:35.599; most accessible tissue: Callus, score: 54.357	N	N	N	N
vg0912864929	C -> T	LOC_Os09g21320.1	upstream_gene_variant ; 740.0bp to feature; MODIFIER	silent_mutation	Average:35.599; most accessible tissue: Callus, score: 54.357	N	N	N	N
vg0912864929	C -> T	LOC_Os09g21330.1	downstream_gene_variant ; 3418.0bp to feature; MODIFIER	silent_mutation	Average:35.599; most accessible tissue: Callus, score: 54.357	N	N	N	N
vg0912864929	C -> T	LOC_Os09g21320-LOC_Os09g21330	intergenic_region ; MODIFIER	silent_mutation	Average:35.599; most accessible tissue: Callus, score: 54.357	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912864929	NA	2.27E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	9.38E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	2.85E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	5.32E-07	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	9.00E-06	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	2.19E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	5.79E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	4.73E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	1.65E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	1.65E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	2.83E-06	1.55E-09	mr1913	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	5.16E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	4.06E-07	3.72E-10	mr1071_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	1.06E-06	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	8.48E-07	1.66E-09	mr1080_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	4.05E-08	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	3.54E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	1.39E-06	3.58E-10	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	1.07E-07	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	3.68E-06	3.14E-11	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	9.54E-07	4.64E-09	mr1619_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	1.99E-08	8.90E-14	mr1795_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	1.81E-09	1.91E-14	mr1913_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929	NA	1.48E-08	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251