\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912864929:

Variant ID: vg0912864929 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12864929
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATAATGGTATGATCCAAATTCACAAATACTGATGGCATATTTTAAAACTGGCATATTTTTAATGGCAATGTATCTAATTAACCCTATCCTATATAGGG[C/T]
GCGTTCTTAATTCTTCATCAAGCATATATATGCATGTGAAACTGACACTGAAGATATAAATTAAATGTTAACAATGTTTCTAGAATTTACGGACGTTGAT

Reverse complement sequence

ATCAACGTCCGTAAATTCTAGAAACATTGTTAACATTTAATTTATATCTTCAGTGTCAGTTTCACATGCATATATATGCTTGATGAAGAATTAAGAACGC[G/A]
CCCTATATAGGATAGGGTTAATTAGATACATTGCCATTAAAAATATGCCAGTTTTAAAATATGCCATCAGTATTTGTGAATTTGGATCATACCATTATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.70% 0.13% 0.17% NA
All Indica  2759 96.50% 3.00% 0.18% 0.29% NA
All Japonica  1512 7.60% 92.30% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 96.80% 1.80% 0.34% 1.01% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.70% 0.25% 0.25% NA
Temperate Japonica  767 3.30% 96.60% 0.13% 0.00% NA
Tropical Japonica  504 15.70% 84.30% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912864929 C -> DEL N N silent_mutation Average:35.599; most accessible tissue: Callus, score: 54.357 N N N N
vg0912864929 C -> T LOC_Os09g21320.1 upstream_gene_variant ; 740.0bp to feature; MODIFIER silent_mutation Average:35.599; most accessible tissue: Callus, score: 54.357 N N N N
vg0912864929 C -> T LOC_Os09g21330.1 downstream_gene_variant ; 3418.0bp to feature; MODIFIER silent_mutation Average:35.599; most accessible tissue: Callus, score: 54.357 N N N N
vg0912864929 C -> T LOC_Os09g21320-LOC_Os09g21330 intergenic_region ; MODIFIER silent_mutation Average:35.599; most accessible tissue: Callus, score: 54.357 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912864929 NA 2.27E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 9.38E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 2.85E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 5.32E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 9.00E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 2.19E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 5.79E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 4.73E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 1.65E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 1.65E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 2.83E-06 1.55E-09 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 5.16E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 4.06E-07 3.72E-10 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 1.06E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 8.48E-07 1.66E-09 mr1080_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 4.05E-08 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 3.54E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 1.39E-06 3.58E-10 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 1.07E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 3.68E-06 3.14E-11 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 9.54E-07 4.64E-09 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 1.99E-08 8.90E-14 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 1.81E-09 1.91E-14 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912864929 NA 1.48E-08 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251