Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912757627:

Variant ID: vg0912757627 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12757627
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCTCCGGCGGATCTTCTTCGTCCCTAAGGATCGGTGGTGGTCGCCGGTGGTCGCCTCGAGGTGGTGGGCGCCAGATCCAGTCTCCAGGTGGTTCGGGA[T/C]
CACCGGATCTGGAACCCCCGGGCTCCGACCGCTGCCTCCTTCACCGTCTGAGCTCCTTCGCTGGTCGCCTCCCCCCGTAACCTTCTTGACGCCAGATCCG

Reverse complement sequence

CGGATCTGGCGTCAAGAAGGTTACGGGGGGAGGCGACCAGCGAAGGAGCTCAGACGGTGAAGGAGGCAGCGGTCGGAGCCCGGGGGTTCCAGATCCGGTG[A/G]
TCCCGAACCACCTGGAGACTGGATCTGGCGCCCACCACCTCGAGGCGACCACCGGCGACCACCACCGATCCTTAGGGACGAAGAAGATCCGCCGGAGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	35.10%	1.48%	0.00%	NA
All Indica	2759	94.10%	4.10%	1.81%	0.00%	NA
All Japonica	1512	7.30%	92.50%	0.13%	0.00%	NA
Aus	269	82.20%	13.40%	4.46%	0.00%	NA
Indica I	595	92.60%	1.30%	6.05%	0.00%	NA
Indica II	465	97.60%	1.90%	0.43%	0.00%	NA
Indica III	913	92.60%	7.20%	0.22%	0.00%	NA
Indica Intermediate	786	94.80%	3.90%	1.27%	0.00%	NA
Temperate Japonica	767	2.90%	96.90%	0.26%	0.00%	NA
Tropical Japonica	504	15.30%	84.70%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	40.60%	57.30%	2.08%	0.00%	NA
Intermediate	90	35.60%	60.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912757627	T -> C	LOC_Os09g21140.1	upstream_gene_variant ; 735.0bp to feature; MODIFIER	silent_mutation	Average:61.991; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0912757627	T -> C	LOC_Os09g21130.1	downstream_gene_variant ; 2361.0bp to feature; MODIFIER	silent_mutation	Average:61.991; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0912757627	T -> C	LOC_Os09g21150.1	downstream_gene_variant ; 3503.0bp to feature; MODIFIER	silent_mutation	Average:61.991; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0912757627	T -> C	LOC_Os09g21130-LOC_Os09g21140	intergenic_region ; MODIFIER	silent_mutation	Average:61.991; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912757627	NA	1.01E-18	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0912757627	NA	5.38E-28	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	6.68E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	5.31E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	7.06E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	1.84E-07	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	1.37E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	3.27E-07	5.58E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	3.34E-06	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	2.51E-06	6.62E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	3.09E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	2.10E-07	5.02E-08	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	3.13E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	1.95E-06	2.23E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	2.89E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	NA	1.87E-07	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	7.31E-06	NA	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912757627	4.21E-09	1.38E-09	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251