\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912640700:

Variant ID: vg0912640700 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12640700
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTGTATCTTTTAATTGTTTAGCTCAAGGAGACATGGACCGTGCAACACAATTTATGATTTTGATATAAGCTATAGTAATCCCTTCAACTCAAACCAA[C/T]
CCCCCCAGATGCATGTCAGCAATTAAAAAGGATCGTCCTACCACCCTCAAGATGTCAACAAGGATGGGAACATATGAACCAACTGATGATCATCCTCTCA

Reverse complement sequence

TGAGAGGATGATCATCAGTTGGTTCATATGTTCCCATCCTTGTTGACATCTTGAGGGTGGTAGGACGATCCTTTTTAATTGCTGACATGCATCTGGGGGG[G/A]
TTGGTTTGAGTTGAAGGGATTACTATAGCTTATATCAAAATCATAAATTGTGTTGCACGGTCCATGTCTCCTTGAGCTAAACAATTAAAAGATACAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.80% 0.30% 0.00% NA
All Indica  2759 82.40% 17.20% 0.43% 0.00% NA
All Japonica  1512 6.20% 93.70% 0.07% 0.00% NA
Aus  269 36.80% 63.20% 0.00% 0.00% NA
Indica I  595 91.30% 8.10% 0.67% 0.00% NA
Indica II  465 88.00% 11.80% 0.22% 0.00% NA
Indica III  913 79.00% 20.80% 0.22% 0.00% NA
Indica Intermediate  786 76.30% 23.00% 0.64% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 13.50% 86.30% 0.20% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 27.80% 71.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912640700 C -> T LOC_Os09g20980.1 downstream_gene_variant ; 1327.0bp to feature; MODIFIER silent_mutation Average:63.489; most accessible tissue: Callus, score: 87.231 N N N N
vg0912640700 C -> T LOC_Os09g20990.1 downstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:63.489; most accessible tissue: Callus, score: 87.231 N N N N
vg0912640700 C -> T LOC_Os09g20980-LOC_Os09g20990 intergenic_region ; MODIFIER silent_mutation Average:63.489; most accessible tissue: Callus, score: 87.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912640700 NA 3.50E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.61E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.77E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 9.71E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 2.02E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 2.80E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 8.95E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 4.72E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.99E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.07E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.18E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.42E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 3.14E-06 NA mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 6.39E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 1.61E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912640700 NA 6.54E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251