Variant ID: vg0912597369 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 12597369 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 200. )
TTTTGGGCACAAGCACTTCTAACTTTGTTTTCGATGAAATTTGAATAATTAGATAATATACACCAAAATCAGAATTGCATCTCCAAAAGTATACTATCGT[A/G]
ATATTGTAGGTTGTTATAATTTATTGAAATTGTTACGAAGAATTATTGGTCGAAGTACGTTGGAGTAGTTTTTTTTTTTTGGAAGAATTATTGGTTGGTT
AACCAACCAATAATTCTTCCAAAAAAAAAAAACTACTCCAACGTACTTCGACCAATAATTCTTCGTAACAATTTCAATAAATTATAACAACCTACAATAT[T/C]
ACGATAGTATACTTTTGGAGATGCAATTCTGATTTTGGTGTATATTATCTAATTATTCAAATTTCATCGAAAACAAAGTTAGAAGTGCTTGTGCCCAAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.60% | 36.90% | 0.38% | 0.11% | NA |
All Indica | 2759 | 93.90% | 5.40% | 0.47% | 0.14% | NA |
All Japonica | 1512 | 6.00% | 93.80% | 0.07% | 0.07% | NA |
Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.20% | 0.50% | 1.01% | 0.34% | NA |
Indica II | 465 | 95.50% | 3.70% | 0.65% | 0.22% | NA |
Indica III | 913 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.50% | 5.90% | 0.51% | 0.13% | NA |
Temperate Japonica | 767 | 2.10% | 97.80% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 12.90% | 86.90% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 33.30% | 62.20% | 4.44% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0912597369 | A -> G | LOC_Os09g20920.1 | upstream_gene_variant ; 4202.0bp to feature; MODIFIER | silent_mutation | Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
vg0912597369 | A -> G | LOC_Os09g20930.1 | upstream_gene_variant ; 3264.0bp to feature; MODIFIER | silent_mutation | Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
vg0912597369 | A -> G | LOC_Os09g20920-LOC_Os09g20930 | intergenic_region ; MODIFIER | silent_mutation | Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
vg0912597369 | A -> DEL | N | N | silent_mutation | Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0912597369 | 3.96E-06 | 3.34E-07 | mr1119 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 3.19E-06 | mr1208 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 4.42E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 1.44E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 2.59E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 4.85E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912597369 | NA | 5.05E-06 | mr1208_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |