\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912597369:

Variant ID: vg0912597369 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12597369
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGGGCACAAGCACTTCTAACTTTGTTTTCGATGAAATTTGAATAATTAGATAATATACACCAAAATCAGAATTGCATCTCCAAAAGTATACTATCGT[A/G]
ATATTGTAGGTTGTTATAATTTATTGAAATTGTTACGAAGAATTATTGGTCGAAGTACGTTGGAGTAGTTTTTTTTTTTTGGAAGAATTATTGGTTGGTT

Reverse complement sequence

AACCAACCAATAATTCTTCCAAAAAAAAAAAACTACTCCAACGTACTTCGACCAATAATTCTTCGTAACAATTTCAATAAATTATAACAACCTACAATAT[T/C]
ACGATAGTATACTTTTGGAGATGCAATTCTGATTTTGGTGTATATTATCTAATTATTCAAATTTCATCGAAAACAAAGTTAGAAGTGCTTGTGCCCAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 36.90% 0.38% 0.11% NA
All Indica  2759 93.90% 5.40% 0.47% 0.14% NA
All Japonica  1512 6.00% 93.80% 0.07% 0.07% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 98.20% 0.50% 1.01% 0.34% NA
Indica II  465 95.50% 3.70% 0.65% 0.22% NA
Indica III  913 90.80% 9.20% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 5.90% 0.51% 0.13% NA
Temperate Japonica  767 2.10% 97.80% 0.13% 0.00% NA
Tropical Japonica  504 12.90% 86.90% 0.00% 0.20% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 33.30% 62.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912597369 A -> G LOC_Os09g20920.1 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0912597369 A -> G LOC_Os09g20930.1 upstream_gene_variant ; 3264.0bp to feature; MODIFIER silent_mutation Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0912597369 A -> G LOC_Os09g20920-LOC_Os09g20930 intergenic_region ; MODIFIER silent_mutation Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0912597369 A -> DEL N N silent_mutation Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912597369 3.96E-06 3.34E-07 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 3.19E-06 mr1208 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 4.42E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 1.44E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 2.59E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 4.85E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369 NA 5.05E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251