Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912597369:

Variant ID: vg0912597369 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12597369
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGGGCACAAGCACTTCTAACTTTGTTTTCGATGAAATTTGAATAATTAGATAATATACACCAAAATCAGAATTGCATCTCCAAAAGTATACTATCGT[A/G]
ATATTGTAGGTTGTTATAATTTATTGAAATTGTTACGAAGAATTATTGGTCGAAGTACGTTGGAGTAGTTTTTTTTTTTTGGAAGAATTATTGGTTGGTT

Reverse complement sequence

AACCAACCAATAATTCTTCCAAAAAAAAAAAACTACTCCAACGTACTTCGACCAATAATTCTTCGTAACAATTTCAATAAATTATAACAACCTACAATAT[T/C]
ACGATAGTATACTTTTGGAGATGCAATTCTGATTTTGGTGTATATTATCTAATTATTCAAATTTCATCGAAAACAAAGTTAGAAGTGCTTGTGCCCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	36.90%	0.38%	0.11%	NA
All Indica	2759	93.90%	5.40%	0.47%	0.14%	NA
All Japonica	1512	6.00%	93.80%	0.07%	0.07%	NA
Aus	269	80.30%	19.70%	0.00%	0.00%	NA
Indica I	595	98.20%	0.50%	1.01%	0.34%	NA
Indica II	465	95.50%	3.70%	0.65%	0.22%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	5.90%	0.51%	0.13%	NA
Temperate Japonica	767	2.10%	97.80%	0.13%	0.00%	NA
Tropical Japonica	504	12.90%	86.90%	0.00%	0.20%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	33.30%	62.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912597369	A -> G	LOC_Os09g20920.1	upstream_gene_variant ; 4202.0bp to feature; MODIFIER	silent_mutation	Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0912597369	A -> G	LOC_Os09g20930.1	upstream_gene_variant ; 3264.0bp to feature; MODIFIER	silent_mutation	Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0912597369	A -> G	LOC_Os09g20920-LOC_Os09g20930	intergenic_region ; MODIFIER	silent_mutation	Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0912597369	A -> DEL	N	N	silent_mutation	Average:65.315; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912597369	3.96E-06	3.34E-07	mr1119	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	3.19E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	4.42E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	1.44E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	2.59E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	4.85E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912597369	NA	5.05E-06	mr1208_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251