\
| Variant ID: vg0912507153 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12507153 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCGGACATCACATAGGGAACGGTTGAAAGCCCTACACCCGGCGCTAGGGGCCGTGGGTTGTCGGCGATCGTATGTCCTCCGTGGATGTCTATCGGATGA[C/T,A]
GAGAATGAAGAGGATGATGATGATGACGATGGGTCACTCGGGTCCGGTGTCCGATTCCGAGGACGACGTTTGGGTTCTCGAGAGTTCTGTCGTCGTCCAC
GTGGACGACGACAGAACTCTCGAGAACCCAAACGTCGTCCTCGGAATCGGACACCGGACCCGAGTGACCCATCGTCATCATCATCATCCTCTTCATTCTC[G/A,T]
TCATCCGATAGACATCCACGGAGGACATACGATCGCCGACAACCCACGGCCCCTAGCGCCGGGTGTAGGGCTTTCAACCGTTCCCTATGTGATGTCCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 15.40% | 1.67% | 37.24% | A: 0.02% |
| All Indica | 2759 | 15.70% | 25.70% | 2.65% | 55.96% | A: 0.04% |
| All Japonica | 1512 | 94.50% | 0.30% | 0.13% | 5.03% | NA |
| Aus | 269 | 55.00% | 0.40% | 1.49% | 43.12% | NA |
| Indica I | 595 | 15.60% | 9.20% | 1.68% | 73.45% | NA |
| Indica II | 465 | 8.80% | 15.70% | 2.58% | 72.90% | NA |
| Indica III | 913 | 15.10% | 44.80% | 3.40% | 36.69% | NA |
| Indica Intermediate | 786 | 20.40% | 21.90% | 2.54% | 55.09% | A: 0.13% |
| Temperate Japonica | 767 | 98.20% | 0.10% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 88.30% | 0.80% | 0.40% | 10.52% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 66.70% | 12.20% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912507153 | C -> DEL | N | N | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> T | LOC_Os09g20750.1 | upstream_gene_variant ; 3994.0bp to feature; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> T | LOC_Os09g20760.1 | downstream_gene_variant ; 522.0bp to feature; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> T | LOC_Os09g20750-LOC_Os09g20760 | intergenic_region ; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> A | LOC_Os09g20750.1 | upstream_gene_variant ; 3994.0bp to feature; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> A | LOC_Os09g20760.1 | downstream_gene_variant ; 522.0bp to feature; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| vg0912507153 | C -> A | LOC_Os09g20750-LOC_Os09g20760 | intergenic_region ; MODIFIER | silent_mutation | Average:9.489; most accessible tissue: Callus, score: 36.93 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912507153 | NA | 4.90E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912507153 | 1.19E-06 | 3.90E-07 | mr1037_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912507153 | NA | 9.30E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912507153 | NA | 2.22E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912507153 | NA | 6.05E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |