\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912507153:

Variant ID: vg0912507153 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12507153
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGACATCACATAGGGAACGGTTGAAAGCCCTACACCCGGCGCTAGGGGCCGTGGGTTGTCGGCGATCGTATGTCCTCCGTGGATGTCTATCGGATGA[C/T,A]
GAGAATGAAGAGGATGATGATGATGACGATGGGTCACTCGGGTCCGGTGTCCGATTCCGAGGACGACGTTTGGGTTCTCGAGAGTTCTGTCGTCGTCCAC

Reverse complement sequence

GTGGACGACGACAGAACTCTCGAGAACCCAAACGTCGTCCTCGGAATCGGACACCGGACCCGAGTGACCCATCGTCATCATCATCATCCTCTTCATTCTC[G/A,T]
TCATCCGATAGACATCCACGGAGGACATACGATCGCCGACAACCCACGGCCCCTAGCGCCGGGTGTAGGGCTTTCAACCGTTCCCTATGTGATGTCCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 15.40% 1.67% 37.24% A: 0.02%
All Indica  2759 15.70% 25.70% 2.65% 55.96% A: 0.04%
All Japonica  1512 94.50% 0.30% 0.13% 5.03% NA
Aus  269 55.00% 0.40% 1.49% 43.12% NA
Indica I  595 15.60% 9.20% 1.68% 73.45% NA
Indica II  465 8.80% 15.70% 2.58% 72.90% NA
Indica III  913 15.10% 44.80% 3.40% 36.69% NA
Indica Intermediate  786 20.40% 21.90% 2.54% 55.09% A: 0.13%
Temperate Japonica  767 98.20% 0.10% 0.00% 1.69% NA
Tropical Japonica  504 88.30% 0.80% 0.40% 10.52% NA
Japonica Intermediate  241 95.90% 0.00% 0.00% 4.15% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 66.70% 12.20% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912507153 C -> DEL N N silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> T LOC_Os09g20750.1 upstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> T LOC_Os09g20760.1 downstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> T LOC_Os09g20750-LOC_Os09g20760 intergenic_region ; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> A LOC_Os09g20750.1 upstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> A LOC_Os09g20760.1 downstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N
vg0912507153 C -> A LOC_Os09g20750-LOC_Os09g20760 intergenic_region ; MODIFIER silent_mutation Average:9.489; most accessible tissue: Callus, score: 36.93 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912507153 NA 4.90E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153 1.19E-06 3.90E-07 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153 NA 9.30E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153 NA 2.22E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153 NA 6.05E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251