Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912507153:

Variant ID: vg0912507153 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12507153
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGGACATCACATAGGGAACGGTTGAAAGCCCTACACCCGGCGCTAGGGGCCGTGGGTTGTCGGCGATCGTATGTCCTCCGTGGATGTCTATCGGATGA[C/T,A]
GAGAATGAAGAGGATGATGATGATGACGATGGGTCACTCGGGTCCGGTGTCCGATTCCGAGGACGACGTTTGGGTTCTCGAGAGTTCTGTCGTCGTCCAC

Reverse complement sequence

GTGGACGACGACAGAACTCTCGAGAACCCAAACGTCGTCCTCGGAATCGGACACCGGACCCGAGTGACCCATCGTCATCATCATCATCCTCTTCATTCTC[G/A,T]
TCATCCGATAGACATCCACGGAGGACATACGATCGCCGACAACCCACGGCCCCTAGCGCCGGGTGTAGGGCTTTCAACCGTTCCCTATGTGATGTCCGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.70%	15.40%	1.67%	37.24%	A: 0.02%
All Indica	2759	15.70%	25.70%	2.65%	55.96%	A: 0.04%
All Japonica	1512	94.50%	0.30%	0.13%	5.03%	NA
Aus	269	55.00%	0.40%	1.49%	43.12%	NA
Indica I	595	15.60%	9.20%	1.68%	73.45%	NA
Indica II	465	8.80%	15.70%	2.58%	72.90%	NA
Indica III	913	15.10%	44.80%	3.40%	36.69%	NA
Indica Intermediate	786	20.40%	21.90%	2.54%	55.09%	A: 0.13%
Temperate Japonica	767	98.20%	0.10%	0.00%	1.69%	NA
Tropical Japonica	504	88.30%	0.80%	0.40%	10.52%	NA
Japonica Intermediate	241	95.90%	0.00%	0.00%	4.15%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	66.70%	12.20%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912507153	C -> DEL	N	N	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> T	LOC_Os09g20750.1	upstream_gene_variant ; 3994.0bp to feature; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> T	LOC_Os09g20760.1	downstream_gene_variant ; 522.0bp to feature; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> T	LOC_Os09g20750-LOC_Os09g20760	intergenic_region ; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> A	LOC_Os09g20750.1	upstream_gene_variant ; 3994.0bp to feature; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> A	LOC_Os09g20760.1	downstream_gene_variant ; 522.0bp to feature; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N
vg0912507153	C -> A	LOC_Os09g20750-LOC_Os09g20760	intergenic_region ; MODIFIER	silent_mutation	Average:9.489; most accessible tissue: Callus, score: 36.93	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912507153	NA	4.90E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153	1.19E-06	3.90E-07	mr1037_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153	NA	9.30E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153	NA	2.22E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912507153	NA	6.05E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251