Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0912501909:

Variant ID: vg0912501909 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12501909
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, C: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGTGGAATATGACTGAAAGACAGGGCCGAGCGTGGCCGAAACAAACTAAAAATGCCTATATTTCCCACTAATACATGTAGGTTGTGCCGGTGCTCAG[A/C]
GTCACGCGAAGCCGAAGCGCAACAAGGTGATAGTGTGCCCTGAAAGTTTTAGTCCATAATGTTTCTACGGTGAAACGTTGTCCAGTTCCCCTCATACTGT

Reverse complement sequence

ACAGTATGAGGGGAACTGGACAACGTTTCACCGTAGAAACATTATGGACTAAAACTTTCAGGGCACACTATCACCTTGTTGCGCTTCGGCTTCGCGTGAC[T/G]
CTGAGCACCGGCACAACCTACATGTATTAGTGGGAAATATAGGCATTTTTAGTTTGTTTCGGCCACGCTCGGCCCTGTCTTTCAGTCATATTCCACCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	17.30%	0.23%	43.19%	NA
All Indica	2759	5.90%	28.30%	0.36%	65.49%	NA
All Japonica	1512	94.40%	0.40%	0.00%	5.22%	NA
Aus	269	46.10%	6.70%	0.37%	46.84%	NA
Indica I	595	11.90%	9.20%	0.67%	78.15%	NA
Indica II	465	3.70%	16.30%	0.43%	79.57%	NA
Indica III	913	0.70%	50.60%	0.00%	48.74%	NA
Indica Intermediate	786	8.70%	23.80%	0.51%	67.05%	NA
Temperate Japonica	767	97.90%	0.30%	0.00%	1.83%	NA
Tropical Japonica	504	88.10%	0.80%	0.00%	11.11%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	87.50%	2.10%	0.00%	10.42%	NA
Intermediate	90	64.40%	14.40%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912501909	A -> DEL	N	N	silent_mutation	Average:13.882; most accessible tissue: Callus, score: 56.473	N	N	N	N
vg0912501909	A -> C	LOC_Os09g20740.1	upstream_gene_variant ; 3337.0bp to feature; MODIFIER	silent_mutation	Average:13.882; most accessible tissue: Callus, score: 56.473	N	N	N	N
vg0912501909	A -> C	LOC_Os09g20750.1	downstream_gene_variant ; 691.0bp to feature; MODIFIER	silent_mutation	Average:13.882; most accessible tissue: Callus, score: 56.473	N	N	N	N
vg0912501909	A -> C	LOC_Os09g20740-LOC_Os09g20750	intergenic_region ; MODIFIER	silent_mutation	Average:13.882; most accessible tissue: Callus, score: 56.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912501909	5.22E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912501909	1.48E-07	NA	mr1016	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251